Third-party software notices Open Vector Editor 0.8.42; bio-parsers 0.4.38 https://github.com/TeselaGen/tg-oss MIT License Copyright (c) 2023 Teselagen Biotechnology, Inc. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @babel/runtime@7.29.7 MIT https://github.com/babel/babel MIT License Copyright (c) 2014-present Sebastian McKenzie and other contributors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @blueprintjs/colors@4.2.1 Apache-2.0 https://github.com/palantir/blueprint Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS ====================================================================== @blueprintjs/core@3.54.0 Apache-2.0 https://github.com/palantir/blueprint Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS ====================================================================== @blueprintjs/datetime@3.24.1 Apache-2.0 https://github.com/palantir/blueprint Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS ====================================================================== @blueprintjs/icons@3.33.0 Apache-2.0 https://github.com/palantir/blueprint Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS ====================================================================== @blueprintjs/select@3.18.11 Apache-2.0 https://github.com/palantir/blueprint Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS ====================================================================== @dmsnell/diff-match-patch@1.1.0 Apache-2.0 https://github.com/dmsnell/diff-match-patch ====================================================================== @dnd-kit/accessibility@3.1.1 MIT https://github.com/clauderic/dnd-kit MIT License Copyright (c) 2021, Claudéric Demers Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @dnd-kit/core@6.3.1 MIT https://github.com/clauderic/dnd-kit MIT License Copyright (c) 2021, Claudéric Demers Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @dnd-kit/modifiers@7.0.0 MIT https://github.com/clauderic/dnd-kit MIT License Copyright (c) 2021, Claudéric Demers Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @dnd-kit/sortable@8.0.0 MIT https://github.com/clauderic/dnd-kit MIT License Copyright (c) 2021, Claudéric Demers Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @dnd-kit/utilities@3.2.2 MIT https://github.com/clauderic/dnd-kit MIT License Copyright (c) 2021, Claudéric Demers Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @gmod/gff@1.3.0 MIT https://github.com/GMOD/gff-js MIT License Copyright (c) 2017 Robert Buels Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @hello-pangea/dnd@16.2.0 Apache-2.0 https://github.com/hello-pangea/dnd Copyright 2021 Gabriel Santerre Copyright 2019 Atlassian Pty Ltd Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== @hypnosphi/create-react-context@0.3.1 MIT https://github.com/thejameskyle/create-react-context Copyright (c) 2017-present James Kyle Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @icons/material@0.2.4 MIT https://github.com/at-icons/material # Material Icons > materialdesignicons.com | | Name :-: | :----------: | `AccessPointIcon` | `AccessPointNetworkIcon` | `AccountAlertIcon` | `AccountBoxIcon` | `AccountBoxOutlineIcon` | `AccountCardDetailsIcon` | `AccountCheckIcon` | `AccountCircleIcon` | `AccountConvertIcon` | `AccountEditIcon` | `AccountGroupIcon` | `AccountHeartIcon` | `AccountIcon` | `AccountKeyIcon` | `AccountLocationIcon` | `AccountMinusIcon` | `AccountMultipleIcon` | `AccountMultipleMinusIcon` | `AccountMultipleOutlineIcon` | `AccountMultiplePlusIcon` | `AccountMultiplePlusOutlineIcon` | `AccountNetworkIcon` | `AccountOffIcon` | `AccountOutlineIcon` | `AccountPlusIcon` | `AccountPlusOutlineIcon` | `AccountRemoveIcon` | `AccountSearchIcon` | `AccountSettingsIcon` | `AccountSettingsVariantIcon` | `AccountStarIcon` | `AccountSwitchIcon` | `AccusoftIcon` | `AdjustIcon` | `AirConditionerIcon` | `AirballoonIcon` | `AirplaneIcon` | `AirplaneLandingIcon` | `AirplaneOffIcon` | `AirplaneTakeoffIcon` | `AirplayIcon` | `AirportIcon` | `AlarmBellIcon` | `AlarmCheckIcon` | `AlarmIcon` | `AlarmLightIcon` | `AlarmMultipleIcon` | `AlarmOffIcon` | `AlarmPlusIcon` | `AlarmSnoozeIcon` | `AlbumIcon` | `AlertBoxIcon` | `AlertCircleIcon` | `AlertCircleOutlineIcon` | `AlertDecagramIcon` | `AlertIcon` | `AlertOctagonIcon` | `AlertOctagramIcon` | `AlertOutlineIcon` | `AlienIcon` | `AllInclusiveIcon` | `AlloIcon` | `AlphaIcon` | `AlphabeticalIcon` | `AltimeterIcon` | `AmazonClouddriveIcon` | `AmazonIcon` | `AmbulanceIcon` | `AmplifierIcon` | `AnchorIcon` | `AndroidDebugBridgeIcon` | `AndroidHeadIcon` | `AndroidIcon` | `AndroidStudioIcon` | `AngularIcon` | `AngularjsIcon` | `AnimationIcon` | `AnvilIcon` | `AppleFinderIcon` | `AppleIcon` | `AppleIosIcon` | `AppleKeyboardCapsIcon` | `AppleKeyboardCommandIcon` | `AppleKeyboardControlIcon` | `AppleKeyboardOptionIcon` | `AppleKeyboardShiftIcon` | `AppleMobilemeIcon` | `AppleSafariIcon` | `ApplicationIcon` | `ApprovalIcon` | `AppsIcon` | `ArchiveIcon` | `ArrangeBringForwardIcon` | `ArrangeBringToFrontIcon` | `ArrangeSendBackwardIcon` | `ArrangeSendToBackIcon` | `ArrowAllIcon` | `ArrowBottomLeftIcon` | `ArrowBottomRightIcon` | `ArrowCollapseAllIcon` | `ArrowCollapseDownIcon` | `ArrowCollapseHorizontalIcon` | `ArrowCollapseIcon` | `ArrowCollapseLeftIcon` | `ArrowCollapseRightIcon` | `ArrowCollapseUpIcon` | `ArrowCollapseVerticalIcon` | `ArrowDownBoldBoxIcon` | `ArrowDownBoldBoxOutlineIcon` | `ArrowDownBoldCircleIcon` | `ArrowDownBoldCircleOutlineIcon` | `ArrowDownBoldHexagonOutlineIcon` | `ArrowDownBoldIcon` | `ArrowDownBoxIcon` | `ArrowDownDropCircleIcon` | `ArrowDownDropCircleOutlineIcon` | `ArrowDownIcon` | `ArrowDownThickIcon` | `ArrowExpandAllIcon` | `ArrowExpandDownIcon` | `ArrowExpandHorizontalIcon` | `ArrowExpandIcon` | `ArrowExpandLeftIcon` | `ArrowExpandRightIcon` | `ArrowExpandUpIcon` | `ArrowExpandVerticalIcon` | `ArrowLeftBoldBoxIcon` | `ArrowLeftBoldBoxOutlineIcon` | `ArrowLeftBoldCircleIcon` | `ArrowLeftBoldCircleOutlineIcon` | `ArrowLeftBoldHexagonOutlineIcon` | `ArrowLeftBoldIcon` | `ArrowLeftBoxIcon` | `ArrowLeftDropCircleIcon` | `ArrowLeftDropCircleOutlineIcon` | `ArrowLeftIcon` | `ArrowLeftThickIcon` | `ArrowRightBoldBoxIcon` | `ArrowRightBoldBoxOutlineIcon` | `ArrowRightBoldCircleIcon` | `ArrowRightBoldCircleOutlineIcon` | `ArrowRightBoldHexagonOutlineIcon` | `ArrowRightBoldIcon` | `ArrowRightBoxIcon` | `ArrowRightDropCircleIcon` | `ArrowRightDropCircleOutlineIcon` | `ArrowRightIcon` | `ArrowRightThickIcon` | `ArrowTopLeftIcon` | `ArrowTopRightIcon` | `ArrowUpBoldBoxIcon` | `ArrowUpBoldBoxOutlineIcon` | `ArrowUpBoldCircleIcon` | `ArrowUpBoldCircleOutlineIcon` | `ArrowUpBoldHexagonOutlineIcon` | `ArrowUpBoldIcon` | `ArrowUpBoxIcon` | `ArrowUpDropCircleIcon` | `ArrowUpDropCircleOutlineIcon` | `ArrowUpIcon` | `ArrowUpThickIcon` | `ArtistIcon` | `AssistantIcon` | `AsteriskIcon` | `AtIcon` | `AtlassianIcon` | `AtomIcon` | `AttachmentIcon` | `AudiobookIcon` | `AugmentedRealityIcon` | `AutoFixIcon` | `AutoUploadIcon` | `AutorenewIcon` | `AvTimerIcon` | `AzureIcon` | `BabyBuggyIcon` | `BabyIcon` | `BackburgerIcon` | `BackspaceIcon` | `BackupRestoreIcon` | `BadmintonIcon` | `BandcampIcon` | `BankIcon` | `BarcodeIcon` | `BarcodeScanIcon` | `BarleyIcon` | `BarrelIcon` | `BaseballBatIcon` | `BaseballIcon` | `BasecampIcon` | `BasketFillIcon` | `BasketIcon` | `BasketUnfillIcon` | `BasketballIcon` | `BatteryAlertIcon` | `BatteryChargingIcon` | `BatteryChargingOutlineIcon` | `BatteryChargingWirelessAlertIcon` | `BatteryChargingWirelessIcon` | `BatteryChargingWirelessOutlineIcon` | `BatteryChargingWireless_10Icon` | `BatteryChargingWireless_20Icon` | `BatteryChargingWireless_30Icon` | `BatteryChargingWireless_40Icon` | `BatteryChargingWireless_50Icon` | `BatteryChargingWireless_60Icon` | `BatteryChargingWireless_70Icon` | `BatteryChargingWireless_80Icon` | `BatteryChargingWireless_90Icon` | `BatteryCharging_100Icon` | `BatteryCharging_10Icon` | `BatteryCharging_20Icon` | `BatteryCharging_30Icon` | `BatteryCharging_40Icon` | `BatteryCharging_50Icon` | `BatteryCharging_60Icon` | `BatteryCharging_70Icon` | `BatteryCharging_80Icon` | `BatteryCharging_90Icon` | `BatteryIcon` | `BatteryMinusIcon` | `BatteryNegativeIcon` | `BatteryOutlineIcon` | `BatteryPlusIcon` | `BatteryPositiveIcon` | `BatteryUnknownIcon` | `Battery_10Icon` | `Battery_20Icon` | `Battery_30Icon` | `Battery_40Icon` | `Battery_50Icon` | `Battery_60Icon` | `Battery_70Icon` | `Battery_80Icon` | `Battery_90Icon` | `BeachIcon` | `BeakerIcon` | `BeatsIcon` | `BedEmptyIcon` | `BeerIcon` | `BehanceIcon` | `BellIcon` | `BellOffIcon` | `BellOutlineIcon` | `BellPlusIcon` | `BellRingIcon` | `BellRingOutlineIcon` | `BellSleepIcon` | `BetaIcon` | `BibleIcon` | `BikeIcon` | `BingIcon` | `BinocularsIcon` | `BioIcon` | `BiohazardIcon` | `BitbucketIcon` | `BitcoinIcon` | `BlackMesaIcon` | `BlackberryIcon` | `BlenderIcon` | `BlindsIcon` | `BlockHelperIcon` | `BloggerIcon` | `BluetoothAudioIcon` | `BluetoothConnectIcon` | `BluetoothIcon` | `BluetoothOffIcon` | `BluetoothSettingsIcon` | `BluetoothTransferIcon` | `BlurIcon` | `BlurLinearIcon` | `BlurOffIcon` | `BlurRadialIcon` | `BombIcon` | `BombOffIcon` | `BoneIcon` | `BookIcon` | `BookMinusIcon` | `BookMultipleIcon` | `BookMultipleVariantIcon` | `BookOpenIcon` | `BookOpenPageVariantIcon` | `BookOpenVariantIcon` | `BookPlusIcon` | `BookSecureIcon` | `BookUnsecureIcon` | `BookVariantIcon` | `BookmarkCheckIcon` | `BookmarkIcon` | `BookmarkMusicIcon` | `BookmarkOutlineIcon` | `BookmarkPlusIcon` | `BookmarkPlusOutlineIcon` | `BookmarkRemoveIcon` | `BoomboxIcon` | `BootstrapIcon` | `BorderAllIcon` | `BorderAllVariantIcon` | `BorderBottomIcon` | `BorderBottomVariantIcon` | `BorderColorIcon` | `BorderHorizontalIcon` | `BorderInsideIcon` | `BorderLeftIcon` | `BorderLeftVariantIcon` | `BorderNoneIcon` | `BorderNoneVariantIcon` | `BorderOutsideIcon` | `BorderRightIcon` | `BorderRightVariantIcon` | `BorderStyleIcon` | `BorderTopIcon` | `BorderTopVariantIcon` | `BorderVerticalIcon` | `BottleWineIcon` | `BowTieIcon` | `BowlIcon` | `BowlingIcon` | `BoxCutterIcon` | `BoxIcon` | `BoxShadowIcon` | `BridgeIcon` | `BriefcaseCheckIcon` | `BriefcaseDownloadIcon` | `BriefcaseIcon` | `BriefcaseOutlineIcon` | `BriefcaseUploadIcon` | `BrightnessAutoIcon` | `Brightness_1Icon` | `Brightness_2Icon` | `Brightness_3Icon` | `Brightness_4Icon` | `Brightness_5Icon` | `Brightness_6Icon` | `Brightness_7Icon` | `BroomIcon` | `BrushIcon` | `BufferIcon` | `BugIcon` | `BulletinBoardIcon` | `BullhornIcon` | `BullseyeIcon` | `BusArticulatedEndIcon` | `BusArticulatedFrontIcon` | `BusDoubleDeckerIcon` | `BusIcon` | `BusSchoolIcon` | `BusSideIcon` | `CachedIcon` | `CakeIcon` | `CakeLayeredIcon` | `CakeVariantIcon` | `CalculatorIcon` | `CalendarBlankIcon` | `CalendarCheckIcon` | `CalendarClockIcon` | `CalendarEditIcon` | `CalendarIcon` | `CalendarMultipleCheckIcon` | `CalendarMultipleIcon` | `CalendarPlusIcon` | `CalendarQuestionIcon` | `CalendarRangeIcon` | `CalendarRemoveIcon` | `CalendarTextIcon` | `CalendarTodayIcon` | `CallMadeIcon` | `CallMergeIcon` | `CallMissedIcon` | `CallReceivedIcon` | `CallSplitIcon` | `CamcorderBoxIcon` | `CamcorderBoxOffIcon` | `CamcorderIcon` | `CamcorderOffIcon` | `CameraBurstIcon` | `CameraEnhanceIcon` | `CameraFrontIcon` | `CameraFrontVariantIcon` | `CameraGoproIcon` | `CameraIcon` | `CameraIrisIcon` | `CameraMeteringCenterIcon` | `CameraMeteringMatrixIcon` | `CameraMeteringPartialIcon` | `CameraMeteringSpotIcon` | `CameraOffIcon` | `CameraPartyModeIcon` | `CameraRearIcon` | `CameraRearVariantIcon` | `CameraSwitchIcon` | `CameraTimerIcon` | `CancelIcon` | `CandleIcon` | `CandycaneIcon` | `CannabisIcon` | `CarBatteryIcon` | `CarConnectedIcon` | `CarConvertibleIcon` | `CarEstateIcon` | `CarHatchbackIcon` | `CarIcon` | `CarPickupIcon` | `CarSideIcon` | `CarSportsIcon` | `CarWashIcon` | `CaravanIcon` | `CardsIcon` | `CardsOutlineIcon` | `CardsPlayingOutlineIcon` | `CardsVariantIcon` | `CarrotIcon` | `CartIcon` | `CartOffIcon` | `CartOutlineIcon` | `CartPlusIcon` | `CaseSensitiveAltIcon` | `CashIcon` | `CashMultipleIcon` | `CashUsdIcon` | `Cash_100Icon` | `CastConnectedIcon` | `CastIcon` | `CastOffIcon` | `CastleIcon` | `CatIcon` | `CctvIcon` | `CeilingLightIcon` | `CellphoneAndroidIcon` | `CellphoneBasicIcon` | `CellphoneDockIcon` | `CellphoneIcon` | `CellphoneIphoneIcon` | `CellphoneLinkIcon` | `CellphoneLinkOffIcon` | `CellphoneSettingsIcon` | `CellphoneWirelessIcon` | `CertificateIcon` | `ChairSchoolIcon` | `ChartArcIcon` | `ChartAreasplineIcon` | `ChartBarIcon` | `ChartBarStackedIcon` | `ChartBubbleIcon` | `ChartDonutIcon` | `ChartDonutVariantIcon` | `ChartGanttIcon` | `ChartHistogramIcon` | `ChartLineIcon` | `ChartLineStackedIcon` | `ChartLineVariantIcon` | `ChartPieIcon` | `ChartScatterplotHexbinIcon` | `ChartTimelineIcon` | `CheckAllIcon` | `CheckCircleIcon` | `CheckCircleOutlineIcon` | `CheckIcon` | `CheckOutlineIcon` | `CheckboxBlankCircleIcon` | `CheckboxBlankCircleOutlineIcon` | `CheckboxBlankIcon` | `CheckboxBlankOutlineIcon` | `CheckboxIntermediateIcon` | `CheckboxMarkedCircleIcon` | `CheckboxMarkedCircleOutlineIcon` | `CheckboxMarkedIcon` | `CheckboxMarkedOutlineIcon` | `CheckboxMultipleBlankCircleIcon` | `CheckboxMultipleBlankCircleOutlineIcon` | `CheckboxMultipleBlankIcon` | `CheckboxMultipleBlankOutlineIcon` | `CheckboxMultipleMarkedCircleIcon` | `CheckboxMultipleMarkedCircleOutlineIcon` | `CheckboxMultipleMarkedIcon` | `CheckboxMultipleMarkedOutlineIcon` | `CheckerboardIcon` | `ChemicalWeaponIcon` | `ChessBishopIcon` | `ChessKingIcon` | `ChessKnightIcon` | `ChessPawnIcon` | `ChessQueenIcon` | `ChessRookIcon` | `ChevronDoubleDownIcon` | `ChevronDoubleLeftIcon` | `ChevronDoubleRightIcon` | `ChevronDoubleUpIcon` | `ChevronDownIcon` | `ChevronLeftIcon` | `ChevronRightIcon` | `ChevronUpIcon` | `ChiliHotIcon` | `ChiliMediumIcon` | `ChiliMildIcon` | `ChipIcon` | `ChurchIcon` | `CircleIcon` | `CircleOutlineIcon` | `CiscoWebexIcon` | `CityIcon` | `ClipboardAccountIcon` | `ClipboardAlertIcon` | `ClipboardArrowDownIcon` | `ClipboardArrowLeftIcon` | `ClipboardCheckIcon` | `ClipboardCheckOutlineIcon` | `ClipboardFlowIcon` | `ClipboardIcon` | `ClipboardOutlineIcon` | `ClipboardPlusIcon` | `ClipboardPulseIcon` | `ClipboardPulseOutlineIcon` | `ClipboardTextIcon` | `ClippyIcon` | `ClockAlertIcon` | `ClockEndIcon` | `ClockFastIcon` | `ClockIcon` | `ClockInIcon` | `ClockOutIcon` | `ClockStartIcon` | `CloseBoxIcon` | `CloseBoxOutlineIcon` | `CloseCircleIcon` | `CloseCircleOutlineIcon` | `CloseIcon` | `CloseNetworkIcon` | `CloseOctagonIcon` | `CloseOctagonOutlineIcon` | `CloseOutlineIcon` | `ClosedCaptionIcon` | `CloudBracesIcon` | `CloudCheckIcon` | `CloudCircleIcon` | `CloudDownloadIcon` | `CloudIcon` | `CloudOffOutlineIcon` | `CloudOutlineIcon` | `CloudPrintIcon` | `CloudPrintOutlineIcon` | `CloudSyncIcon` | `CloudTagsIcon` | `CloudUploadIcon` | `CloverIcon` | `CodeArrayIcon` | `CodeBracesIcon` | `CodeBracketsIcon` | `CodeEqualIcon` | `CodeGreaterThanIcon` | `CodeGreaterThanOrEqualIcon` | `CodeLessThanIcon` | `CodeLessThanOrEqualIcon` | `CodeNotEqualIcon` | `CodeNotEqualVariantIcon` | `CodeParenthesesIcon` | `CodeStringIcon` | `CodeTagsCheckIcon` | `CodeTagsIcon` | `CodepenIcon` | `CoffeeIcon` | `CoffeeOutlineIcon` | `CoffeeToGoIcon` | `CoinIcon` | `CoinsIcon` | `CollageIcon` | `ColorHelperIcon` | `CommentAccountIcon` | `CommentAccountOutlineIcon` | `CommentAlertIcon` | `CommentAlertOutlineIcon` | `CommentCheckIcon` | `CommentCheckOutlineIcon` | `CommentIcon` | `CommentMultipleIcon` | `CommentMultipleOutlineIcon` | `CommentOutlineIcon` | `CommentPlusOutlineIcon` | `CommentProcessingIcon` | `CommentProcessingOutlineIcon` | `CommentQuestionIcon` | `CommentQuestionOutlineIcon` | `CommentRemoveIcon` | `CommentRemoveOutlineIcon` | `CommentTextIcon` | `CommentTextMultipleIcon` | `CommentTextMultipleOutlineIcon` | `CommentTextOutlineIcon` | `CompareIcon` | `CompassIcon` | `CompassOutlineIcon` | `ConsoleIcon` | `ConsoleLineIcon` | `ConsoleNetworkIcon` | `ContactMailIcon` | `ContactsIcon` | `ContentCopyIcon` | `ContentCutIcon` | `ContentDuplicateIcon` | `ContentPasteIcon` | `ContentSaveAllIcon` | `ContentSaveIcon` | `ContentSaveOutlineIcon` | `ContentSaveSettingsIcon` | `ContrastBoxIcon` | `ContrastCircleIcon` | `ContrastIcon` | `CookieIcon` | `CopyrightIcon` | `CornIcon` | `CounterIcon` | `CowIcon` | `CraneIcon` | `CreationIcon` | `CreditCardIcon` | `CreditCardMultipleIcon` | `CreditCardOffIcon` | `CreditCardPlusIcon` | `CreditCardScanIcon` | `CropFreeIcon` | `CropIcon` | `CropLandscapeIcon` | `CropPortraitIcon` | `CropRotateIcon` | `CropSquareIcon` | `CrosshairsGpsIcon` | `CrosshairsIcon` | `CrownIcon` | `CubeIcon` | `CubeOutlineIcon` | `CubeSendIcon` | `CubeUnfoldedIcon` | `CupIcon` | `CupOffIcon` | `CupWaterIcon` | `CurlingIcon` | `CurrencyBdtIcon` | `CurrencyBtcIcon` | `CurrencyChfIcon` | `CurrencyCnyIcon` | `CurrencyEthIcon` | `CurrencyEurIcon` | `CurrencyGbpIcon` | `CurrencyInrIcon` | `CurrencyJpyIcon` | `CurrencyKrwIcon` | `CurrencyKztIcon` | `CurrencyNgnIcon` | `CurrencyRubIcon` | `CurrencySignIcon` | `CurrencyTryIcon` | `CurrencyTwdIcon` | `CurrencyUsdIcon` | `CurrencyUsdOffIcon` | `CursorDefaultIcon` | `CursorDefaultOutlineIcon` | `CursorMoveIcon` | `CursorPointerIcon` | `CursorTextIcon` | `DatabaseIcon` | `DatabaseMinusIcon` | `DatabasePlusIcon` | `DatabaseSearchIcon` | `DebugStepIntoIcon` | `DebugStepOutIcon` | `DebugStepOverIcon` | `DecagramIcon` | `DecagramOutlineIcon` | `DecimalDecreaseIcon` | `DecimalIncreaseIcon` | `DeleteCircleIcon` | `DeleteEmptyIcon` | `DeleteForeverIcon` | `DeleteIcon` | `DeleteRestoreIcon` | `DeleteSweepIcon` | `DeleteVariantIcon` | `DeltaIcon` | `DeskphoneIcon` | `DesktopClassicIcon` | `DesktopMacIcon` | `DesktopTowerIcon` | `DetailsIcon` | `DeveloperBoardIcon` | `DeviantartIcon` | `DialpadIcon` | `DiamondIcon` | `DiceD10Icon` | `DiceD12Icon` | `DiceD20Icon` | `DiceD4Icon` | `DiceD6Icon` | `DiceD8Icon` | `DiceMultipleIcon` | `Dice_1Icon` | `Dice_2Icon` | `Dice_3Icon` | `Dice_4Icon` | `Dice_5Icon` | `Dice_6Icon` | `DictionaryIcon` | `DipSwitchIcon` | `DirectionsForkIcon` | `DirectionsIcon` | `DiscordIcon` | `DiskAlertIcon` | `DiskIcon` | `DisqusIcon` | `DisqusOutlineIcon` | `DivisionBoxIcon` | `DivisionIcon` | `DnaIcon` | `DnsIcon` | `DoNotDisturbIcon` | `DoNotDisturbOffIcon` | `DockerIcon` | `DolbyIcon` | `DomainIcon` | `DonkeyIcon` | `DoorClosedIcon` | `DoorIcon` | `DoorOpenIcon` | `DoorbellVideoIcon` | `DotsHorizontalCircleIcon` | `DotsHorizontalIcon` | `DotsVerticalCircleIcon` | `DotsVerticalIcon` | `DoubanIcon` | `DownloadIcon` | `DownloadNetworkIcon` | `DragHorizontalIcon` | `DragIcon` | `DragVerticalIcon` | `DrawingBoxIcon` | `DrawingIcon` | `DribbbleBoxIcon` | `DribbbleIcon` | `DroneIcon` | `DropboxIcon` | `DrupalIcon` | `DuckIcon` | `DumbbellIcon` | `EarHearingIcon` | `EarthBoxIcon` | `EarthBoxOffIcon` | `EarthIcon` | `EarthOffIcon` | `EdgeIcon` | `EjectIcon` | `ElephantIcon` | `ElevationDeclineIcon` | `ElevationRiseIcon` | `ElevatorIcon` | `EmailAlertIcon` | `EmailIcon` | `EmailOpenIcon` | `EmailOpenOutlineIcon` | `EmailOutlineIcon` | `EmailSecureIcon` | `EmailVariantIcon` | `EmbyIcon` | `EmoticonCoolIcon` | `EmoticonDeadIcon` | `EmoticonDevilIcon` | `EmoticonExcitedIcon` | `EmoticonHappyIcon` | `EmoticonIcon` | `EmoticonNeutralIcon` | `EmoticonPoopIcon` | `EmoticonSadIcon` | `EmoticonTongueIcon` | `EngineIcon` | `EngineOutlineIcon` | `EqualBoxIcon` | `EqualIcon` | `EraserIcon` | `EraserVariantIcon` | `EscalatorIcon` | `EthereumIcon` | `EthernetCableIcon` | `EthernetCableOffIcon` | `EthernetIcon` | `EtsyIcon` | `EvStationIcon` | `EventbriteIcon` | `EvernoteIcon` | `ExclamationIcon` | `ExitToAppIcon` | `ExportIcon` | `EyeIcon` | `EyeOffIcon` | `EyeOffOutlineIcon` | `EyeOutlineIcon` | `EyePlusIcon` | `EyePlusOutlineIcon` | `EyeSettingsIcon` | `EyeSettingsOutlineIcon` | `EyedropperIcon` | `EyedropperVariantIcon` | `FaceIcon` | `FaceProfileIcon` | `FacebookBoxIcon` | `FacebookIcon` | `FacebookMessengerIcon` | `FactoryIcon` | `FanIcon` | `FanOffIcon` | `FastForwardIcon` | `FastForwardOutlineIcon` | `FaxIcon` | `FeatherIcon` | `FerryIcon` | `FileAccountIcon` | `FileChartIcon` | `FileCheckIcon` | `FileCloudIcon` | `FileCompareIcon` | `FileDelimitedIcon` | `FileDocumentBoxIcon` | `FileDocumentIcon` | `FileExcelBoxIcon` | `FileExcelIcon` | `FileExportIcon` | `FileFindIcon` | `FileHiddenIcon` | `FileIcon` | `FileImageIcon` | `FileImportIcon` | `FileLockIcon` | `FileMultipleIcon` | `FileMusicIcon` | `FileOutlineIcon` | `FilePdfBoxIcon` | `FilePdfIcon` | `FilePercentIcon` | `FilePlusIcon` | `FilePowerpointBoxIcon` | `FilePowerpointIcon` | `FilePresentationBoxIcon` | `FileQuestionIcon` | `FileRestoreIcon` | `FileSendIcon` | `FileTreeIcon` | `FileVideoIcon` | `FileWordBoxIcon` | `FileWordIcon` | `FileXmlIcon` | `FilmIcon` | `FilmstripIcon` | `FilmstripOffIcon` | `FilterIcon` | `FilterOutlineIcon` | `FilterRemoveIcon` | `FilterRemoveOutlineIcon` | `FilterVariantIcon` | `FinanceIcon` | `FindReplaceIcon` | `FingerprintIcon` | `FireIcon` | `FireTruckIcon` | `FirefoxIcon` | `FishIcon` | `FlagCheckeredIcon` | `FlagIcon` | `FlagOutlineIcon` | `FlagTriangleIcon` | `FlagVariantIcon` | `FlagVariantOutlineIcon` | `FlashAutoIcon` | `FlashCircleIcon` | `FlashIcon` | `FlashOffIcon` | `FlashOutlineIcon` | `FlashRedEyeIcon` | `FlashlightIcon` | `FlashlightOffIcon` | `FlaskEmptyIcon` | `FlaskEmptyOutlineIcon` | `FlaskIcon` | `FlaskOutlineIcon` | `FlattrIcon` | `FlipToBackIcon` | `FlipToFrontIcon` | `FloorPlanIcon` | `FloppyIcon` | `FlowerIcon` | `FolderAccountIcon` | `FolderDownloadIcon` | `FolderGoogleDriveIcon` | `FolderIcon` | `FolderImageIcon` | `FolderKeyIcon` | `FolderKeyNetworkIcon` | `FolderLockIcon` | `FolderLockOpenIcon` | `FolderMoveIcon` | `FolderMultipleIcon` | `FolderMultipleImageIcon` | `FolderMultipleOutlineIcon` | `FolderNetworkIcon` | `FolderOpenIcon` | `FolderOutlineIcon` | `FolderPlusIcon` | `FolderRemoveIcon` | `FolderStarIcon` | `FolderUploadIcon` | `FontAwesomeIcon` | `FoodAppleIcon` | `FoodCroissantIcon` | `FoodForkDrinkIcon` | `FoodIcon` | `FoodOffIcon` | `FoodVariantIcon` | `FootballAustralianIcon` | `FootballHelmetIcon` | `FootballIcon` | `ForkliftIcon` | `FormatAlignBottomIcon` | `FormatAlignCenterIcon` | `FormatAlignJustifyIcon` | `FormatAlignLeftIcon` | `FormatAlignMiddleIcon` | `FormatAlignRightIcon` | `FormatAlignTopIcon` | `FormatAnnotationPlusIcon` | `FormatBoldIcon` | `FormatClearIcon` | `FormatColorFillIcon` | `FormatColorTextIcon` | `FormatFloatCenterIcon` | `FormatFloatLeftIcon` | `FormatFloatNoneIcon` | `FormatFloatRightIcon` | `FormatFontIcon` | `FormatHeaderDecreaseIcon` | `FormatHeaderEqualIcon` | `FormatHeaderIncreaseIcon` | `FormatHeaderPoundIcon` | `FormatHeader_1Icon` | `FormatHeader_2Icon` | `FormatHeader_3Icon` | `FormatHeader_4Icon` | `FormatHeader_5Icon` | `FormatHeader_6Icon` | `FormatHorizontalAlignCenterIcon` | `FormatHorizontalAlignLeftIcon` | `FormatHorizontalAlignRightIcon` | `FormatIndentDecreaseIcon` | `FormatIndentIncreaseIcon` | `FormatItalicIcon` | `FormatLineSpacingIcon` | `FormatLineStyleIcon` | `FormatLineWeightIcon` | `FormatListBulletedIcon` | `FormatListBulletedTypeIcon` | `FormatListChecksIcon` | `FormatListNumbersIcon` | `FormatPageBreakIcon` | `FormatPaintIcon` | `FormatParagraphIcon` | `FormatPilcrowIcon` | `FormatQuoteCloseIcon` | `FormatQuoteOpenIcon` | `FormatRotate_90Icon` | `FormatSectionIcon` | `FormatSizeIcon` | `FormatStrikethroughIcon` | `FormatStrikethroughVariantIcon` | `FormatSubscriptIcon` | `FormatSuperscriptIcon` | `FormatTextIcon` | `FormatTextdirectionLToRIcon` | `FormatTextdirectionRToLIcon` | `FormatTitleIcon` | `FormatUnderlineIcon` | `FormatVerticalAlignBottomIcon` | `FormatVerticalAlignCenterIcon` | `FormatVerticalAlignTopIcon` | `FormatWrapInlineIcon` | `FormatWrapSquareIcon` | `FormatWrapTightIcon` | `FormatWrapTopBottomIcon` | `ForumIcon` | `ForumOutlineIcon` | `ForwardIcon` | `FoursquareIcon` | `FridgeFilledBottomIcon` | `FridgeFilledIcon` | `FridgeFilledTopIcon` | `FridgeIcon` | `FuelIcon` | `FullscreenExitIcon` | `FullscreenIcon` | `FunctionIcon` | `FunctionVariantIcon` | `GamepadIcon` | `GamepadVariantIcon` | `GarageAlertIcon` | `GarageIcon` | `GarageOpenIcon` | `GasCylinderIcon` | `GasStationIcon` | `GateIcon` | `GaugeEmptyIcon` | `GaugeFullIcon` | `GaugeIcon` | `GaugeLowIcon` | `GavelIcon` | `GenderFemaleIcon` | `GenderMaleFemaleIcon` | `GenderMaleIcon` | `GenderTransgenderIcon` | `GestureDoubleTapIcon` | `GestureIcon` | `GestureSwipeDownIcon` | `GestureSwipeLeftIcon` | `GestureSwipeRightIcon` | `GestureSwipeUpIcon` | `GestureTapIcon` | `GestureTwoDoubleTapIcon` | `GestureTwoTapIcon` | `GhostIcon` | `GiftIcon` | `GitIcon` | `GithubBoxIcon` | `GithubCircleIcon` | `GithubFaceIcon` | `GlassCocktailIcon` | `GlassFluteIcon` | `GlassMugIcon` | `GlassStangeIcon` | `GlassTulipIcon` | `GlassWineIcon` | `GlassdoorIcon` | `GlassesIcon` | `GmailIcon` | `GnomeIcon` | `GolfIcon` | `GondolaIcon` | `GoogleAnalyticsIcon` | `GoogleAssistantIcon` | `GoogleCardboardIcon` | `GoogleChromeIcon` | `GoogleCirclesCommunitiesIcon` | `GoogleCirclesExtendedIcon` | `GoogleCirclesGroupIcon` | `GoogleCirclesIcon` | `GoogleControllerIcon` | `GoogleControllerOffIcon` | `GoogleDriveIcon` | `GoogleEarthIcon` | `GoogleGlassIcon` | `GoogleHomeIcon` | `GoogleIcon` | `GoogleKeepIcon` | `GoogleMapsIcon` | `GoogleNearbyIcon` | `GooglePagesIcon` | `GooglePhotosIcon` | `GooglePhysicalWebIcon` | `GooglePlayIcon` | `GooglePlusBoxIcon` | `GooglePlusIcon` | `GoogleTranslateIcon` | `GoogleWalletIcon` | `GpuIcon` | `GradientIcon` | `GraphqlIcon` | `GreasePencilIcon` | `GridIcon` | `GridLargeIcon` | `GridOffIcon` | `GroupIcon` | `GuitarAcousticIcon` | `GuitarElectricIcon` | `GuitarPickIcon` | `GuitarPickOutlineIcon` | `GuyFawkesMaskIcon` | `HackernewsIcon` | `HamburgerIcon` | `HandPointingRightIcon` | `HangerIcon` | `HangoutsIcon` | `HarddiskIcon` | `HeadphonesBoxIcon` | `HeadphonesIcon` | `HeadphonesOffIcon` | `HeadphonesSettingsIcon` | `HeadsetDockIcon` | `HeadsetIcon` | `HeadsetOffIcon` | `HeartBoxIcon` | `HeartBoxOutlineIcon` | `HeartBrokenIcon` | `HeartHalfFullIcon` | `HeartHalfIcon` | `HeartHalfOutlineIcon` | `HeartIcon` | `HeartOffIcon` | `HeartOutlineIcon` | `HeartPulseIcon` | `HelpBoxIcon` | `HelpCircleIcon` | `HelpCircleOutlineIcon` | `HelpIcon` | `HelpNetworkIcon` | `HexagonIcon` | `HexagonMultipleIcon` | `HexagonOutlineIcon` | `HighDefinitionBoxIcon` | `HighDefinitionIcon` | `HighwayIcon` | `HistoryIcon` | `HockeyPuckIcon` | `HockeySticksIcon` | `HololensIcon` | `HomeAccountIcon` | `HomeAlertIcon` | `HomeAssistantIcon` | `HomeAutomationIcon` | `HomeCircleIcon` | `HomeCurrencyUsdIcon` | `HomeHeartIcon` | `HomeIcon` | `HomeMapMarkerIcon` | `HomeModernIcon` | `HomeOutlineIcon` | `HomeVariantIcon` | `HookIcon` | `HookOffIcon` | `HopsIcon` | `HospitalBuildingIcon` | `HospitalIcon` | `HospitalMarkerIcon` | `HotTubIcon` | `HotelIcon` | `HouzzBoxIcon` | `HouzzIcon` | `HuluIcon` | `HumanChildIcon` | `HumanFemaleIcon` | `HumanGreetingIcon` | `HumanHandsdownIcon` | `HumanHandsupIcon` | `HumanIcon` | `HumanMaleFemaleIcon` | `HumanMaleIcon` | `HumanPregnantIcon` | `HumbleBundleIcon` | `IceCreamIcon` | `ImageAlbumIcon` | `ImageAreaCloseIcon` | `ImageAreaIcon` | `ImageBrokenIcon` | `ImageBrokenVariantIcon` | `ImageFilterBlackWhiteIcon` | `ImageFilterCenterFocusIcon` | `ImageFilterCenterFocusWeakIcon` | `ImageFilterDramaIcon` | `ImageFilterFramesIcon` | `ImageFilterHdrIcon` | `ImageFilterIcon` | `ImageFilterNoneIcon` | `ImageFilterTiltShiftIcon` | `ImageFilterVintageIcon` | `ImageIcon` | `ImageMultipleIcon` | `ImageOffIcon` | `ImagePlusIcon` | `ImportIcon` | `InboxArrowDownIcon` | `InboxArrowUpIcon` | `InboxIcon` | `InboxMultipleIcon` | `IncognitoIcon` | `InfinityIcon` | `InformationIcon` | `InformationOutlineIcon` | `InformationVariantIcon` | `InstagramIcon` | `InstapaperIcon` | `InternetExplorerIcon` | `InvertColorsIcon` | `ItunesIcon` | `JeepneyIcon` | `JiraIcon` | `JqueryIcon` | `JsfiddleIcon` | `JsonIcon` | `KarateIcon` | `KegIcon` | `KettleIcon` | `KeyChangeIcon` | `KeyIcon` | `KeyMinusIcon` | `KeyPlusIcon` | `KeyRemoveIcon` | `KeyVariantIcon` | `KeyboardBackspaceIcon` | `KeyboardCapsIcon` | `KeyboardCloseIcon` | `KeyboardIcon` | `KeyboardOffIcon` | `KeyboardReturnIcon` | `KeyboardTabIcon` | `KeyboardVariantIcon` | `KickstarterIcon` | `KodiIcon` | `LabelIcon` | `LabelOutlineIcon` | `LadybugIcon` | `LambdaIcon` | `LampIcon` | `LanConnectIcon` | `LanDisconnectIcon` | `LanIcon` | `LanPendingIcon` | `LanguageCIcon` | `LanguageCppIcon` | `LanguageCsharpIcon` | `LanguageCss3Icon` | `LanguageGoIcon` | `LanguageHtml5Icon` | `LanguageJavascriptIcon` | `LanguageLuaIcon` | `LanguagePhpIcon` | `LanguagePythonIcon` | `LanguagePythonTextIcon` | `LanguageRIcon` | `LanguageSwiftIcon` | `LanguageTypescriptIcon` | `LaptopChromebookIcon` | `LaptopIcon` | `LaptopMacIcon` | `LaptopOffIcon` | `LaptopWindowsIcon` | `LastfmIcon` | `LastpassIcon` | `LaunchIcon` | `LavaLampIcon` | `LayersIcon` | `LayersOffIcon` | `LeadPencilIcon` | `LeafIcon` | `LedOffIcon` | `LedOnIcon` | `LedOutlineIcon` | `LedStripIcon` | `LedVariantOffIcon` | `LedVariantOnIcon` | `LedVariantOutlineIcon` | `LibraryBooksIcon` | `LibraryIcon` | `LibraryMusicIcon` | `LibraryPlusIcon` | `LifebuoyIcon` | `LightbulbIcon` | `LightbulbOnIcon` | `LightbulbOnOutlineIcon` | `LightbulbOutlineIcon` | `LinkIcon` | `LinkOffIcon` | `LinkVariantIcon` | `LinkVariantOffIcon` | `LinkedinBoxIcon` | `LinkedinIcon` | `LinuxIcon` | `LoadingIcon` | `LockIcon` | `LockOpenIcon` | `LockOpenOutlineIcon` | `LockOutlineIcon` | `LockPatternIcon` | `LockPlusIcon` | `LockResetIcon` | `LockSmartIcon` | `LockerIcon` | `LockerMultipleIcon` | `LoginIcon` | `LoginVariantIcon` | `LogoutIcon` | `LogoutVariantIcon` | `LooksIcon` | `LoopIcon` | `LoupeIcon` | `LumxIcon` | `MagnetIcon` | `MagnetOnIcon` | `MagnifyIcon` | `MagnifyMinusIcon` | `MagnifyMinusOutlineIcon` | `MagnifyPlusIcon` | `MagnifyPlusOutlineIcon` | `MailRuIcon` | `MailboxIcon` | `MapIcon` | `MapMarkerCircleIcon` | `MapMarkerIcon` | `MapMarkerMinusIcon` | `MapMarkerMultipleIcon` | `MapMarkerOffIcon` | `MapMarkerOutlineIcon` | `MapMarkerPlusIcon` | `MapMarkerRadiusIcon` | `MarginIcon` | `MarkdownIcon` | `MarkerCheckIcon` | `MarkerIcon` | `MaterialUiIcon` | `MathCompassIcon` | `MatrixIcon` | `MaxcdnIcon` | `MedicalBagIcon` | `MediumIcon` | `MemoryIcon` | `MenuDownIcon` | `MenuDownOutlineIcon` | `MenuIcon` | `MenuLeftIcon` | `MenuRightIcon` | `MenuUpIcon` | `MenuUpOutlineIcon` | `MessageAlertIcon` | `MessageBulletedIcon` | `MessageBulletedOffIcon` | `MessageDrawIcon` | `MessageIcon` | `MessageImageIcon` | `MessageOutlineIcon` | `MessagePlusIcon` | `MessageProcessingIcon` | `MessageReplyIcon` | `MessageReplyTextIcon` | `MessageSettingsIcon` | `MessageSettingsVariantIcon` | `MessageTextIcon` | `MessageTextOutlineIcon` | `MessageVideoIcon` | `MeteorIcon` | `MetronomeIcon` | `MetronomeTickIcon` | `MicroSdIcon` | `MicrophoneIcon` | `MicrophoneMinusIcon` | `MicrophoneOffIcon` | `MicrophoneOutlineIcon` | `MicrophonePlusIcon` | `MicrophoneSettingsIcon` | `MicrophoneVariantIcon` | `MicrophoneVariantOffIcon` | `MicroscopeIcon` | `MicrosoftIcon` | `MinecraftIcon` | `MinusBoxIcon` | `MinusBoxOutlineIcon` | `MinusCircleIcon` | `MinusCircleOutlineIcon` | `MinusIcon` | `MinusNetworkIcon` | `MixcloudIcon` | `MixedRealityIcon` | `MixerIcon` | `MonitorIcon` | `MonitorMultipleIcon` | `MoreIcon` | `MotorbikeIcon` | `MouseIcon` | `MouseOffIcon` | `MouseVariantIcon` | `MouseVariantOffIcon` | `MoveResizeIcon` | `MoveResizeVariantIcon` | `MovieIcon` | `MovieRollIcon` | `MultiplicationBoxIcon` | `MultiplicationIcon` | `MushroomIcon` | `MushroomOutlineIcon` | `MusicBoxIcon` | `MusicBoxOutlineIcon` | `MusicCircleIcon` | `MusicIcon` | `MusicNoteBluetoothIcon` | `MusicNoteBluetoothOffIcon` | `MusicNoteEighthIcon` | `MusicNoteHalfIcon` | `MusicNoteIcon` | `MusicNoteOffIcon` | `MusicNoteQuarterIcon` | `MusicNoteSixteenthIcon` | `MusicNoteWholeIcon` | `MusicOffIcon` | `NativescriptIcon` | `NatureIcon` | `NaturePeopleIcon` | `NavigationIcon` | `NearMeIcon` | `NeedleIcon` | `NestProtectIcon` | `NestThermostatIcon` | `NetflixIcon` | `NetworkIcon` | `NewBoxIcon` | `NewspaperIcon` | `NfcIcon` | `NfcTapIcon` | `NfcVariantIcon` | `NinjaIcon` | `NintendoSwitchIcon` | `NodejsIcon` | `NoteIcon` | `NoteMultipleIcon` | `NoteMultipleOutlineIcon` | `NoteOutlineIcon` | `NotePlusIcon` | `NotePlusOutlineIcon` | `NoteTextIcon` | `NotebookIcon` | `NotificationClearAllIcon` | `NpmIcon` | `NukeIcon` | `NullIcon` | `NumericIcon` | `Numeric_0BoxIcon` | `Numeric_0BoxMultipleOutlineIcon` | `Numeric_0BoxOutlineIcon` | `Numeric_1BoxIcon` | `Numeric_1BoxMultipleOutlineIcon` | `Numeric_1BoxOutlineIcon` | `Numeric_2BoxIcon` | `Numeric_2BoxMultipleOutlineIcon` | `Numeric_2BoxOutlineIcon` | `Numeric_3BoxIcon` | `Numeric_3BoxMultipleOutlineIcon` | `Numeric_3BoxOutlineIcon` | `Numeric_4BoxIcon` | `Numeric_4BoxMultipleOutlineIcon` | `Numeric_4BoxOutlineIcon` | `Numeric_5BoxIcon` | `Numeric_5BoxMultipleOutlineIcon` | `Numeric_5BoxOutlineIcon` | `Numeric_6BoxIcon` | `Numeric_6BoxMultipleOutlineIcon` | `Numeric_6BoxOutlineIcon` | `Numeric_7BoxIcon` | `Numeric_7BoxMultipleOutlineIcon` | `Numeric_7BoxOutlineIcon` | `Numeric_8BoxIcon` | `Numeric_8BoxMultipleOutlineIcon` | `Numeric_8BoxOutlineIcon` | `Numeric_9BoxIcon` | `Numeric_9BoxMultipleOutlineIcon` | `Numeric_9BoxOutlineIcon` | `Numeric_9PlusBoxIcon` | `Numeric_9PlusBoxMultipleOutlineIcon` | `Numeric_9PlusBoxOutlineIcon` | `NutIcon` | `NutritionIcon` | `OarIcon` | `OctagonIcon` | `OctagonOutlineIcon` | `OctagramIcon` | `OctagramOutlineIcon` | `OdnoklassnikiIcon` | `OfficeIcon` | `OilIcon` | `OilTemperatureIcon` | `OmegaIcon` | `OnedriveIcon` | `OnenoteIcon` | `OnepasswordIcon` | `OpacityIcon` | `OpenInAppIcon` | `OpenInNewIcon` | `OpenidIcon` | `OperaIcon` | `OrbitIcon` | `OrnamentIcon` | `OrnamentVariantIcon` | `OwlIcon` | `PackageDownIcon` | `PackageIcon` | `PackageUpIcon` | `PackageVariantClosedIcon` | `PackageVariantIcon` | `PageFirstIcon` | `PageLastIcon` | `PageLayoutBodyIcon` | `PageLayoutFooterIcon` | `PageLayoutHeaderIcon` | `PageLayoutSidebarLeftIcon` | `PageLayoutSidebarRightIcon` | `PaletteAdvancedIcon` | `PaletteIcon` | `PaletteSwatchIcon` | `PandaIcon` | `PandoraIcon` | `PanoramaFisheyeIcon` | `PanoramaHorizontalIcon` | `PanoramaIcon` | `PanoramaVerticalIcon` | `PanoramaWideAngleIcon` | `PaperCutVerticalIcon` | `PaperclipIcon` | `ParkingIcon` | `PassportIcon` | `PatreonIcon` | `PauseCircleIcon` | `PauseCircleOutlineIcon` | `PauseIcon` | `PauseOctagonIcon` | `PauseOctagonOutlineIcon` | `PawIcon` | `PawOffIcon` | `PaypalIcon` | `PeaceIcon` | `PenIcon` | `PencilBoxIcon` | `PencilBoxOutlineIcon` | `PencilCircleIcon` | `PencilCircleOutlineIcon` | `PencilIcon` | `PencilLockIcon` | `PencilOffIcon` | `PentagonIcon` | `PentagonOutlineIcon` | `PercentIcon` | `PeriodicTableCo2Icon` | `PeriodicTableIcon` | `PeriscopeIcon` | `PharmacyIcon` | `PhoneBluetoothIcon` | `PhoneClassicIcon` | `PhoneForwardIcon` | `PhoneHangupIcon` | `PhoneIcon` | `PhoneInTalkIcon` | `PhoneIncomingIcon` | `PhoneLockedIcon` | `PhoneLogIcon` | `PhoneMinusIcon` | `PhoneMissedIcon` | `PhoneOutgoingIcon` | `PhonePausedIcon` | `PhonePlusIcon` | `PhoneReturnIcon` | `PhoneRotateLandscapeIcon` | `PhoneRotatePortraitIcon` | `PhoneSettingsIcon` | `PhoneVoipIcon` | `PiBoxIcon` | `PiIcon` | `PianoIcon` | `PickaxeIcon` | `PierCraneIcon` | `PierIcon` | `PigIcon` | `PillIcon` | `PillarIcon` | `PinIcon` | `PinOffIcon` | `PineTreeBoxIcon` | `PineTreeIcon` | `PinterestBoxIcon` | `PinterestIcon` | `PipeDisconnectedIcon` | `PipeIcon` | `PipeLeakIcon` | `PistolIcon` | `PistonIcon` | `PizzaIcon` | `PlaneShieldIcon` | `PlayBoxOutlineIcon` | `PlayCircleIcon` | `PlayCircleOutlineIcon` | `PlayIcon` | `PlayNetworkIcon` | `PlayPauseIcon` | `PlayProtectedContentIcon` | `PlaylistCheckIcon` | `PlaylistMinusIcon` | `PlaylistPlayIcon` | `PlaylistPlusIcon` | `PlaylistRemoveIcon` | `PlaystationIcon` | `PlexIcon` | `PlusBoxIcon` | `PlusBoxOutlineIcon` | `PlusCircleIcon` | `PlusCircleMultipleOutlineIcon` | `PlusCircleOutlineIcon` | `PlusIcon` | `PlusNetworkIcon` | `PlusOneIcon` | `PlusOutlineIcon` | `PocketIcon` | `PokeballIcon` | `PokerChipIcon` | `PolaroidIcon` | `PollBoxIcon` | `PollIcon` | `PolymerIcon` | `PoolIcon` | `PopcornIcon` | `PotIcon` | `PotMixIcon` | `PoundBoxIcon` | `PoundIcon` | `PowerIcon` | `PowerPlugIcon` | `PowerPlugOffIcon` | `PowerSettingsIcon` | `PowerSocketEuIcon` | `PowerSocketIcon` | `PowerSocketUkIcon` | `PowerSocketUsIcon` | `PrescriptionIcon` | `PresentationIcon` | `PresentationPlayIcon` | `PrinterAlertIcon` | `PrinterIcon` | `PrinterSettingsIcon` | `Printer_3dIcon` | `PriorityHighIcon` | `PriorityLowIcon` | `ProfessionalHexagonIcon` | `ProjectorIcon` | `ProjectorScreenIcon` | `PublishIcon` | `PulseIcon` | `PuzzleIcon` | `QqchatIcon` | `QrcodeEditIcon` | `QrcodeIcon` | `QrcodeScanIcon` | `QuadcopterIcon` | `QualityHighIcon` | `QuicktimeIcon` | `RadarIcon` | `RadiatorIcon` | `RadioHandheldIcon` | `RadioIcon` | `RadioTowerIcon` | `RadioactiveIcon` | `RadioboxBlankIcon` | `RadioboxMarkedIcon` | `RaspberrypiIcon` | `RayEndArrowIcon` | `RayEndIcon` | `RayStartArrowIcon` | `RayStartEndIcon` | `RayStartIcon` | `RayVertexIcon` | `ReactIcon` | `ReadIcon` | `ReceiptIcon` | `RecordIcon` | `RecordRecIcon` | `RecycleIcon` | `RedditIcon` | `RedoIcon` | `RedoVariantIcon` | `RefreshIcon` | `RegexIcon` | `RelativeScaleIcon` | `ReloadIcon` | `ReminderIcon` | `RemoteDesktopIcon` | `RemoteIcon` | `RenameBoxIcon` | `ReorderHorizontalIcon` | `ReorderVerticalIcon` | `RepeatIcon` | `RepeatOffIcon` | `RepeatOnceIcon` | `ReplayIcon` | `ReplyAllIcon` | `ReplyIcon` | `ReproductionIcon` | `ResizeBottomRightIcon` | `ResponsiveIcon` | `RestartIcon` | `RestoreIcon` | `RewindIcon` | `RewindOutlineIcon` | `RhombusIcon` | `RhombusOutlineIcon` | `RibbonIcon` | `RiceIcon` | `RingIcon` | `RoadIcon` | `RoadVariantIcon` | `RobotIcon` | `RocketIcon` | `RoomServiceIcon` | `RoombaIcon` | `RotateLeftIcon` | `RotateLeftVariantIcon` | `RotateRightIcon` | `RotateRightVariantIcon` | `Rotate_3dIcon` | `RoundedCornerIcon` | `RouterWirelessIcon` | `RoutesIcon` | `RowingIcon` | `RssBoxIcon` | `RssIcon` | `RulerIcon` | `RunFastIcon` | `RunIcon` | `SaleIcon` | `SalesforceIcon` | `SassIcon` | `SatelliteIcon` | `SatelliteVariantIcon` | `SausageIcon` | `SaxophoneIcon` | `ScaleBalanceIcon` | `ScaleBathroomIcon` | `ScaleIcon` | `ScannerIcon` | `SchoolIcon` | `ScreenRotationIcon` | `ScreenRotationLockIcon` | `ScrewdriverIcon` | `ScriptIcon` | `SdIcon` | `SealIcon` | `SearchWebIcon` | `SeatFlatAngledIcon` | `SeatFlatIcon` | `SeatIndividualSuiteIcon` | `SeatLegroomExtraIcon` | `SeatLegroomNormalIcon` | `SeatLegroomReducedIcon` | `SeatReclineExtraIcon` | `SeatReclineNormalIcon` | `SecurityAccountIcon` | `SecurityHomeIcon` | `SecurityIcon` | `SecurityNetworkIcon` | `SelectAllIcon` | `SelectIcon` | `SelectInverseIcon` | `SelectOffIcon` | `SelectionIcon` | `SelectionOffIcon` | `SendIcon` | `SendSecureIcon` | `SerialPortIcon` | `ServerIcon` | `ServerMinusIcon` | `ServerNetworkIcon` | `ServerNetworkOffIcon` | `ServerOffIcon` | `ServerPlusIcon` | `ServerRemoveIcon` | `ServerSecurityIcon` | `SetAllIcon` | `SetCenterIcon` | `SetCenterRightIcon` | `SetLeftCenterIcon` | `SetLeftIcon` | `SetLeftRightIcon` | `SetNoneIcon` | `SetRightIcon` | `SettingsBoxIcon` | `SettingsIcon` | `SettingsOutlineIcon` | `ShapeCirclePlusIcon` | `ShapeIcon` | `ShapeOutlineIcon` | `ShapePlusIcon` | `ShapePolygonPlusIcon` | `ShapeRectanglePlusIcon` | `ShapeSquarePlusIcon` | `ShareIcon` | `ShareVariantIcon` | `ShieldHalfFullIcon` | `ShieldIcon` | `ShieldOutlineIcon` | `ShipWheelIcon` | `ShoppingIcon` | `ShoppingMusicIcon` | `ShovelIcon` | `ShovelOffIcon` | `ShredderIcon` | `ShuffleDisabledIcon` | `ShuffleIcon` | `ShuffleVariantIcon` | `SigmaIcon` | `SigmaLowerIcon` | `SignCautionIcon` | `SignDirectionIcon` | `SignTextIcon` | `SignalCellularOutlineIcon` | `SignalCellular_1Icon` | `SignalCellular_2Icon` | `SignalCellular_3Icon` | `SignalHspaIcon` | `SignalHspaPlusIcon` | `SignalIcon` | `SignalOffIcon` | `SignalVariantIcon` | `Signal_2gIcon` | `Signal_3gIcon` | `Signal_4gIcon` | `SilverwareForkIcon` | `SilverwareIcon` | `SilverwareSpoonIcon` | `SilverwareVariantIcon` | `SimAlertIcon` | `SimIcon` | `SimOffIcon` | `SitemapIcon` | `SkipBackwardIcon` | `SkipForwardIcon` | `SkipNextCircleIcon` | `SkipNextCircleOutlineIcon` | `SkipNextIcon` | `SkipPreviousCircleIcon` | `SkipPreviousCircleOutlineIcon` | `SkipPreviousIcon` | `SkullIcon` | `SkypeBusinessIcon` | `SkypeIcon` | `SlackIcon` | `SleepIcon` | `SleepOffIcon` | `SmokingIcon` | `SmokingOffIcon` | `SnapchatIcon` | `SnowflakeIcon` | `SnowmanIcon` | `SoccerFieldIcon` | `SoccerIcon` | `SofaIcon` | `SolidIcon` | `SortAlphabeticalIcon` | `SortAscendingIcon` | `SortDescendingIcon` | `SortIcon` | `SortNumericIcon` | `SortVariantIcon` | `SoundcloudIcon` | `SourceBranchIcon` | `SourceCommitEndIcon` | `SourceCommitEndLocalIcon` | `SourceCommitIcon` | `SourceCommitLocalIcon` | `SourceCommitNextLocalIcon` | `SourceCommitStartIcon` | `SourceCommitStartNextLocalIcon` | `SourceForkIcon` | `SourceMergeIcon` | `SourcePullIcon` | `SoySauceIcon` | `SpeakerIcon` | `SpeakerOffIcon` | `SpeakerWirelessIcon` | `SpeedometerIcon` | `SpellcheckIcon` | `SpotifyIcon` | `SpotlightBeamIcon` | `SpotlightIcon` | `SprayIcon` | `SquareIcon` | `SquareIncCashIcon` | `SquareIncIcon` | `SquareOutlineIcon` | `SquareRootIcon` | `SshIcon` | `StackOverflowIcon` | `StackexchangeIcon` | `StadiumIcon` | `StairsIcon` | `StandardDefinitionIcon` | `StarCircleIcon` | `StarHalfIcon` | `StarIcon` | `StarOffIcon` | `StarOutlineIcon` | `SteamIcon` | `SteeringIcon` | `StepBackwardIcon` | `StepBackward_2Icon` | `StepForwardIcon` | `StepForward_2Icon` | `StethoscopeIcon` | `StickerEmojiIcon` | `StickerIcon` | `StockingIcon` | `StopCircleIcon` | `StopCircleOutlineIcon` | `StopIcon` | `StoreIcon` | `Store_24HourIcon` | `StoveIcon` | `SubdirectoryArrowLeftIcon` | `SubdirectoryArrowRightIcon` | `SubwayIcon` | `SubwayVariantIcon` | `SummitIcon` | `SunglassesIcon` | `SurroundSoundIcon` | `SurroundSound_2_0Icon` | `SurroundSound_3_1Icon` | `SurroundSound_5_1Icon` | `SurroundSound_7_1Icon` | `SvgIcon` | `SwapHorizontalIcon` | `SwapHorizontalVariantIcon` | `SwapVerticalIcon` | `SwapVerticalVariantIcon` | `SwimIcon` | `SwitchIcon` | `SwordCrossIcon` | `SwordIcon` | `SyncAlertIcon` | `SyncIcon` | `SyncOffIcon` | `TabIcon` | `TabPlusIcon` | `TabUnselectedIcon` | `TableColumnIcon` | `TableColumnPlusAfterIcon` | `TableColumnPlusBeforeIcon` | `TableColumnRemoveIcon` | `TableColumnWidthIcon` | `TableEditIcon` | `TableIcon` | `TableLargeIcon` | `TableOfContentsIcon` | `TableRowHeightIcon` | `TableRowIcon` | `TableRowPlusAfterIcon` | `TableRowPlusBeforeIcon` | `TableRowRemoveIcon` | `TableSettingsIcon` | `TabletAndroidIcon` | `TabletIcon` | `TabletIpadIcon` | `TacoIcon` | `TagFacesIcon` | `TagHeartIcon` | `TagIcon` | `TagMultipleIcon` | `TagOutlineIcon` | `TagPlusIcon` | `TagRemoveIcon` | `TagTextOutlineIcon` | `TargetIcon` | `TaxiIcon` | `TeachIcon` | `TeamviewerIcon` | `TelegramIcon` | `TelevisionBoxIcon` | `TelevisionClassicIcon` | `TelevisionClassicOffIcon` | `TelevisionGuideIcon` | `TelevisionIcon` | `TelevisionOffIcon` | `TemperatureCelsiusIcon` | `TemperatureFahrenheitIcon` | `TemperatureKelvinIcon` | `TennisIcon` | `TentIcon` | `TerrainIcon` | `TestTubeIcon` | `TextShadowIcon` | `TextToSpeechIcon` | `TextToSpeechOffIcon` | `TextboxIcon` | `TextboxPasswordIcon` | `TextureIcon` | `TheaterIcon` | `ThemeLightDarkIcon` | `ThermometerIcon` | `ThermometerLinesIcon` | `ThermostatBoxIcon` | `ThoughtBubbleIcon` | `ThoughtBubbleOutlineIcon` | `ThumbDownIcon` | `ThumbDownOutlineIcon` | `ThumbUpIcon` | `ThumbUpOutlineIcon` | `ThumbsUpDownIcon` | `TicketAccountIcon` | `TicketConfirmationIcon` | `TicketIcon` | `TicketPercentIcon` | `TieIcon` | `TildeIcon` | `TimelapseIcon` | `TimerIcon` | `TimerOffIcon` | `TimerSandEmptyIcon` | `TimerSandFullIcon` | `TimerSandIcon` | `Timer_10Icon` | `Timer_3Icon` | `TimetableIcon` | `ToggleSwitchIcon` | `ToggleSwitchOffIcon` | `TooltipEditIcon` | `TooltipIcon` | `TooltipImageIcon` | `TooltipOutlineIcon` | `TooltipOutlinePlusIcon` | `TooltipTextIcon` | `ToothIcon` | `ToothOutlineIcon` | `TorIcon` | `TowerBeachIcon` | `TowerFireIcon` | `TowingIcon` | `TrackpadIcon` | `TractorIcon` | `TrafficLightIcon` | `TrainIcon` | `TrainVariantIcon` | `TramIcon` | `TranscribeCloseIcon` | `TranscribeIcon` | `TransferIcon` | `TransitTransferIcon` | `TranslateIcon` | `TreasureChestIcon` | `TreeIcon` | `TrelloIcon` | `TrendingDownIcon` | `TrendingNeutralIcon` | `TrendingUpIcon` | `TriangleIcon` | `TriangleOutlineIcon` | `TrophyAwardIcon` | `TrophyIcon` | `TrophyOutlineIcon` | `TrophyVariantIcon` | `TrophyVariantOutlineIcon` | `TruckDeliveryIcon` | `TruckFastIcon` | `TruckIcon` | `TruckTrailerIcon` | `TshirtCrewIcon` | `TshirtVIcon` | `TumblrIcon` | `TumblrReblogIcon` | `TuneIcon` | `TuneVerticalIcon` | `TwitchIcon` | `TwitterBoxIcon` | `TwitterCircleIcon` | `TwitterIcon` | `TwitterRetweetIcon` | `UberIcon` | `UbuntuIcon` | `UltraHighDefinitionIcon` | `UmbracoIcon` | `UmbrellaIcon` | `UmbrellaOutlineIcon` | `UndoIcon` | `UndoVariantIcon` | `UnfoldLessHorizontalIcon` | `UnfoldLessVerticalIcon` | `UnfoldMoreHorizontalIcon` | `UnfoldMoreVerticalIcon` | `UngroupIcon` | `UnityIcon` | `UntappdIcon` | `UpdateIcon` | `UploadIcon` | `UploadMultipleIcon` | `UploadNetworkIcon` | `UsbIcon` | `VanPassengerIcon` | `VanUtilityIcon` | `VanishIcon` | `VectorArrangeAboveIcon` | `VectorArrangeBelowIcon` | `VectorCircleIcon` | `VectorCircleVariantIcon` | `VectorCombineIcon` | `VectorCurveIcon` | `VectorDifferenceAbIcon` | `VectorDifferenceBaIcon` | `VectorDifferenceIcon` | `VectorEllipseIcon` | `VectorIntersectionIcon` | `VectorLineIcon` | `VectorPointIcon` | `VectorPolygonIcon` | `VectorPolylineIcon` | `VectorRadiusIcon` | `VectorRectangleIcon` | `VectorSelectionIcon` | `VectorSquareIcon` | `VectorTriangleIcon` | `VectorUnionIcon` | `VenmoIcon` | `VerifiedIcon` | `VibrateIcon` | `VideoIcon` | `VideoInputAntennaIcon` | `VideoInputComponentIcon` | `VideoInputHdmiIcon` | `VideoInputSvideoIcon` | `VideoOffIcon` | `VideoSwitchIcon` | `Video_3dIcon` | `Video_4kBoxIcon` | `ViewAgendaIcon` | `ViewArrayIcon` | `ViewCarouselIcon` | `ViewColumnIcon` | `ViewDashboardIcon` | `ViewDashboardVariantIcon` | `ViewDayIcon` | `ViewGridIcon` | `ViewHeadlineIcon` | `ViewListIcon` | `ViewModuleIcon` | `ViewParallelIcon` | `ViewQuiltIcon` | `ViewSequentialIcon` | `ViewStreamIcon` | `ViewWeekIcon` | `VimeoIcon` | `ViolinIcon` | `VirtualRealityIcon` | `VisualstudioIcon` | `VkBoxIcon` | `VkCircleIcon` | `VkIcon` | `VlcIcon` | `VoiceIcon` | `VoicemailIcon` | `VolumeHighIcon` | `VolumeLowIcon` | `VolumeMediumIcon` | `VolumeMinusIcon` | `VolumeMuteIcon` | `VolumeOffIcon` | `VolumePlusIcon` | `VpnIcon` | `VuejsIcon` | `WalkIcon` | `WallIcon` | `WalletGiftcardIcon` | `WalletIcon` | `WalletMembershipIcon` | `WalletTravelIcon` | `WanIcon` | `WashingMachineIcon` | `WatchExportIcon` | `WatchExportVariantIcon` | `WatchIcon` | `WatchImportIcon` | `WatchImportVariantIcon` | `WatchVariantIcon` | `WatchVibrateIcon` | `WaterIcon` | `WaterOffIcon` | `WaterPercentIcon` | `WaterPumpIcon` | `WatermarkIcon` | `WavesIcon` | `WeatherCloudyIcon` | `WeatherFogIcon` | `WeatherHailIcon` | `WeatherHurricaneIcon` | `WeatherLightningIcon` | `WeatherLightningRainyIcon` | `WeatherNightIcon` | `WeatherPartlycloudyIcon` | `WeatherPouringIcon` | `WeatherRainyIcon` | `WeatherSnowyIcon` | `WeatherSnowyRainyIcon` | `WeatherSunnyIcon` | `WeatherSunsetDownIcon` | `WeatherSunsetIcon` | `WeatherSunsetUpIcon` | `WeatherWindyIcon` | `WeatherWindyVariantIcon` | `WebIcon` | `WebcamIcon` | `WebhookIcon` | `WebpackIcon` | `WechatIcon` | `WeightIcon` | `WeightKilogramIcon` | `WhatsappIcon` | `WheelchairAccessibilityIcon` | `WhiteBalanceAutoIcon` | `WhiteBalanceIncandescentIcon` | `WhiteBalanceIridescentIcon` | `WhiteBalanceSunnyIcon` | `WidgetsIcon` | `WifiIcon` | `WifiOffIcon` | `WiiIcon` | `WiiuIcon` | `WikipediaIcon` | `WindowCloseIcon` | `WindowClosedIcon` | `WindowMaximizeIcon` | `WindowMinimizeIcon` | `WindowOpenIcon` | `WindowRestoreIcon` | `WindowsIcon` | `WordpressIcon` | `WorkerIcon` | `WrapIcon` | `WrenchIcon` | `WunderlistIcon` | `XamarinIcon` | `XamarinOutlineIcon` | `XamlIcon` | `XboxControllerBatteryAlertIcon` | `XboxControllerBatteryEmptyIcon` | `XboxControllerBatteryFullIcon` | `XboxControllerBatteryLowIcon` | `XboxControllerBatteryMediumIcon` | `XboxControllerBatteryUnknownIcon` | `XboxControllerIcon` | `XboxControllerOffIcon` | `XboxIcon` | `XdaIcon` | `XingBoxIcon` | `XingCircleIcon` | `XingIcon` | `XmlIcon` | `XmppIcon` | `YammerIcon` | `YeastIcon` | `YelpIcon` | `YinYangIcon` | `YoutubeCreatorStudioIcon` | `YoutubeGamingIcon` | `YoutubePlayIcon` | `YoutubeTvIcon` | `ZipBoxIcon` | `index` ====================================================================== @isaacs/cliui@8.0.2 ISC https://github.com/yargs/cliui Copyright (c) 2015, Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== @juggle/resize-observer@3.4.0 Apache-2.0 https://github.com/juggle/resize-observer Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "[]" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright 2019 JUGGLE LTD Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== @npmcli/fs@3.1.1 ISC https://github.com/npm/fs ISC License Copyright npm, Inc. Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND NPM DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL NPM BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== @nx-js/observer-util@4.2.2 MIT https://github.com/nx-js/observer-util The MIT License (MIT) Copyright (c) 2016 RisingStack Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @pkgjs/parseargs@0.11.0 MIT https://github.com/pkgjs/parseargs Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "[]" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright [yyyy] [name of copyright owner] Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== @popperjs/core@2.11.8 MIT https://github.com/popperjs/popper-core The MIT License (MIT) Copyright (c) 2019 Federico Zivolo Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @risingstack/react-easy-state@6.3.0 MIT https://github.com/RisingStack/react-easy-state MIT License Copyright (c) 2019 Miklos Bertalan Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @teselagen/bio-parsers@0.4.37 UNKNOWN https://github.com/TeselaGen/tg-oss # Bio Parsers - [Bio Parsers](#bio-parsers) - [About this Repo](#about-this-repo) - [[CHANGELOG](CHANGELOG.md)](#changelogchangelogmd) - [Exported Functions](#exported-functions) - [Format Specification](#format-specification) - [Usage](#usage) - [install](#install) - [jsonToGenbank (same interface as jsonToFasta)](#jsontogenbank-same-interface-as-jsontofasta) - [anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)](#anytojson-same-interface-as-genbanktojson-fastatojson-xxxxtojson-async-required) - [Options (for anyToJson or xxxxToJson)](#options-for-anytojson-or-xxxxtojson) - [ab1ToJson](#ab1tojson) - [snapgeneToJson (.dna files)](#snapgenetojson-dna-files) - [genbankToJson](#genbanktojson) - [Updating this repo](#updating-this-repo) - [Outside collaborators](#outside-collaborators) - [Thanks/Collaborators](#thankscollaborators) ## About this Repo This repo contains a set of parsers to convert between datatypes through a generalized JSON format. ## [CHANGELOG](CHANGELOG.md) ## Exported Functions Use the following exports to convert to a generalized JSON format: ``` fastaToJson //handles fasta files (.fa, .fasta) genbankToJson //handles genbank files (.gb, .gbk) ab1ToJson //handles .ab1 sequencing read files sbolXmlToJson //handles .sbol files geneiousXmlToJson //handles .genious files jbeiXmlToJson //handles jbei .seq or .xml files snapgeneToJson //handles snapgene (.dna) files anyToJson //this handles any of the above file types based on file extension ``` Use the following exports to convert from a generalized JSON format back to a specific format: ``` jsonToGenbank jsonToFasta jsonToBed ``` ## Format Specification The generalized JSON format looks like: ```js const generalizedJsonFormat = { size: 25, sequence: "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa", circular: true, name: "pBbS8c-RFP", description: "", parts: [ { name: "part 1", type: "CDS", //optional for parts id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you start: 10, //0-based inclusive index end: 30, //0-based inclusive index strand: 1, notes: {} } ], primers: [ { name: "primer 1", id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you start: 10, //0-based inclusive index end: 30, //0-based inclusive index strand: 1, notes: {} } ], features: [ { name: "anonymous feature", type: "misc_feature", id: "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you start: 1, end: 3, strand: 1, notes: {} }, { name: "coding region 1", type: "CDS", id: "5590c1d88979df000a4f02f5", start: 12, end: 9, strand: -1, notes: {} } ], //only if parsing in an ab1 file chromatogramData: { aTrace: [], //same as cTrace but for a tTrace: [], //same as cTrace but for t gTrace: [], //same as cTrace but for g cTrace: [0, 0, 0, 1, 3, 5, 11, 24, 56, 68, 54, 30, 21, 3, 1, 4, 1, 0, 0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000) basePos: [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced) baseCalls: ["A", "T", ...etc], qualNums: [] //or undefined if no qualNums are detected on the file } }; ``` ## Usage ### install `npm install -S @teselagen/bio-parsers` or `yarn add @teselagen/bio-parsers` or use it from a script tag: ```html ``` see the `./umd_demo.html` file for a full working example ### jsonToGenbank (same interface as jsonToFasta) ```js //To go from json to genbank: import { jsonToGenbank } from "bio-parsers" //You can pass an optional options object as the second argument. Here are the defaults const options = { isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true) guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag) guessIfProteinOptions: { threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA }, inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive // Example: // 0123456 // ATGAGAG // --fff-- (the feature covers GAG) // 0-based inclusive start: // feature.start = 2 // 1-based inclusive start: // feature.start = 3 // 0-based inclusive end: // feature.end = 4 // 1-based inclusive end: // feature.end = 5 } const genbankString = jsonToGenbank(generalizedJsonFormat, options) ``` ### anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required) ```js import { anyToJson } from "bio-parsers"; //note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed) const results = await anyToJson( stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to! ); //we always return an array of results because some files my contain multiple sequences results[0].success; //either true or false results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process results[0].parsedSequence; //this will be the generalized json format as specified above :) //chromatogram data will be here (ab1 only): results[0].parsedSequence.chromatogramData; ``` ### Options (for anyToJson or xxxxToJson) ```js //You can pass an optional options object as the third argument. Here are the defaults const options = { fileName: "example.gb", //the filename is used if none is found in the genbank isProtein: false, //if you know that it is a protein string being parsed you can pass true here parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true //genbankToJson options only inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the sequenceData.parts array. Setting this to false will keep them as features instead // fastaToJson options only parseName: true //by default attempt to parse the name and description of sequence from the comment line. Setting this to false will keep the name unchanged with no description } ``` ### ab1ToJson ```js import { ab1ToJson } from "bio-parsers"; const results = await ab1ToJson( //this can be either a browser file // or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1'))); file, options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to! ); //we always return an array of results because some files my contain multiple sequences results[0].success; //either true or false results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process results[0].parsedSequence; //this will be the generalized json format as specified above :) //chromatogram data will be here (ab1 only): results[0].parsedSequence.chromatogramData; ``` ### snapgeneToJson (.dna files) ```js import { snapgeneToJson } from "bio-parsers"; //file can be either a browser file // or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1'))); const results = await snapgeneToJson(file, options); ``` ### genbankToJson ```js import { genbankToJson } from "bio-parsers"; const result = genbankToJson(string, options); console.info(result); // [ // { // "messages": [ // "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn", // "Invalid feature end: 1384 detected for Homo sapiens and set to 1", // ], // "success": true, // "parsedSequence": { // "features": [ // { // "notes": { // "organism": [ // "Homo sapiens" // ], // "db_xref": [ // "taxon:9606" // ], // "chromosome": [ // "17" // ], // "map": [ // "17q21" // ] // }, // "type": "source", // "strand": 1, // "name": "Homo sapiens", // "start": 0, // "end": 1 // } // ], // "name": "NP_003623", // "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag", // "circular": true, // "extraLines": [ // "DEFINITION contactin-associated protein 1 precursor [Homo sapiens].", // "ACCESSION NP_003623", // "VERSION NP_003623.1 GI:4505463", // "DBSOURCE REFSEQ: accession NM_003632.2", // "KEYWORDS RefSeq." // ], // "type": "DNA", // "size": 925 // } // } // ] ``` You can see more examples by looking at the tests. ## Updating this repo ### Outside collaborators fork and pull request please :) ## Thanks/Collaborators - IsaacLuo - https://github.com/IsaacLuo/SnapGeneFileReader (from which the snapgene parser was adapted) - Joshua Nixon (original collaborator) - Thomas Rich (original collaborator) ====================================================================== @teselagen/bio-parsers@0.4.38 UNKNOWN https://github.com/TeselaGen/tg-oss # Bio Parsers - [Bio Parsers](#bio-parsers) - [About this Repo](#about-this-repo) - [[CHANGELOG](CHANGELOG.md)](#changelogchangelogmd) - [Exported Functions](#exported-functions) - [Format Specification](#format-specification) - [Usage](#usage) - [install](#install) - [jsonToGenbank (same interface as jsonToFasta)](#jsontogenbank-same-interface-as-jsontofasta) - [anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)](#anytojson-same-interface-as-genbanktojson-fastatojson-xxxxtojson-async-required) - [Options (for anyToJson or xxxxToJson)](#options-for-anytojson-or-xxxxtojson) - [ab1ToJson](#ab1tojson) - [snapgeneToJson (.dna files)](#snapgenetojson-dna-files) - [genbankToJson](#genbanktojson) - [Updating this repo](#updating-this-repo) - [Outside collaborators](#outside-collaborators) - [Thanks/Collaborators](#thankscollaborators) ## About this Repo This repo contains a set of parsers to convert between datatypes through a generalized JSON format. ## [CHANGELOG](CHANGELOG.md) ## Exported Functions Use the following exports to convert to a generalized JSON format: ``` fastaToJson //handles fasta files (.fa, .fasta) genbankToJson //handles genbank files (.gb, .gbk) ab1ToJson //handles .ab1 sequencing read files sbolXmlToJson //handles .sbol files geneiousXmlToJson //handles .genious files jbeiXmlToJson //handles jbei .seq or .xml files snapgeneToJson //handles snapgene (.dna) files anyToJson //this handles any of the above file types based on file extension ``` Use the following exports to convert from a generalized JSON format back to a specific format: ``` jsonToGenbank jsonToFasta jsonToBed ``` ## Format Specification The generalized JSON format looks like: ```js const generalizedJsonFormat = { size: 25, sequence: "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa", circular: true, name: "pBbS8c-RFP", description: "", parts: [ { name: "part 1", type: "CDS", //optional for parts id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you start: 10, //0-based inclusive index end: 30, //0-based inclusive index strand: 1, notes: {} } ], primers: [ { name: "primer 1", id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you start: 10, //0-based inclusive index end: 30, //0-based inclusive index strand: 1, notes: {} } ], features: [ { name: "anonymous feature", type: "misc_feature", id: "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you start: 1, end: 3, strand: 1, notes: {} }, { name: "coding region 1", type: "CDS", id: "5590c1d88979df000a4f02f5", start: 12, end: 9, strand: -1, notes: {} } ], //only if parsing in an ab1 file chromatogramData: { aTrace: [], //same as cTrace but for a tTrace: [], //same as cTrace but for t gTrace: [], //same as cTrace but for g cTrace: [0, 0, 0, 1, 3, 5, 11, 24, 56, 68, 54, 30, 21, 3, 1, 4, 1, 0, 0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000) basePos: [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced) baseCalls: ["A", "T", ...etc], qualNums: [] //or undefined if no qualNums are detected on the file } }; ``` ## Usage ### install `npm install -S @teselagen/bio-parsers` or `yarn add @teselagen/bio-parsers` or use it from a script tag: ```html ``` see the `./umd_demo.html` file for a full working example ### jsonToGenbank (same interface as jsonToFasta) ```js //To go from json to genbank: import { jsonToGenbank } from "bio-parsers" //You can pass an optional options object as the second argument. Here are the defaults const options = { isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true) guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag) guessIfProteinOptions: { threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA }, inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive // Example: // 0123456 // ATGAGAG // --fff-- (the feature covers GAG) // 0-based inclusive start: // feature.start = 2 // 1-based inclusive start: // feature.start = 3 // 0-based inclusive end: // feature.end = 4 // 1-based inclusive end: // feature.end = 5 } const genbankString = jsonToGenbank(generalizedJsonFormat, options) ``` ### anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required) ```js import { anyToJson } from "bio-parsers"; //note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed) const results = await anyToJson( stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to! ); //we always return an array of results because some files my contain multiple sequences results[0].success; //either true or false results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process results[0].parsedSequence; //this will be the generalized json format as specified above :) //chromatogram data will be here (ab1 only): results[0].parsedSequence.chromatogramData; ``` ### Options (for anyToJson or xxxxToJson) ```js //You can pass an optional options object as the third argument. Here are the defaults const options = { fileName: "example.gb", //the filename is used if none is found in the genbank isProtein: false, //if you know that it is a protein string being parsed you can pass true here parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true //genbankToJson options only inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the sequenceData.parts array. Setting this to false will keep them as features instead // fastaToJson options only parseName: true //by default attempt to parse the name and description of sequence from the comment line. Setting this to false will keep the name unchanged with no description } ``` ### ab1ToJson ```js import { ab1ToJson } from "bio-parsers"; const results = await ab1ToJson( //this can be either a browser file // or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1'))); file, options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to! ); //we always return an array of results because some files my contain multiple sequences results[0].success; //either true or false results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process results[0].parsedSequence; //this will be the generalized json format as specified above :) //chromatogram data will be here (ab1 only): results[0].parsedSequence.chromatogramData; ``` ### snapgeneToJson (.dna files) ```js import { snapgeneToJson } from "bio-parsers"; //file can be either a browser file // or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1'))); const results = await snapgeneToJson(file, options); ``` ### genbankToJson ```js import { genbankToJson } from "bio-parsers"; const result = genbankToJson(string, options); console.info(result); // [ // { // "messages": [ // "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn", // "Invalid feature end: 1384 detected for Homo sapiens and set to 1", // ], // "success": true, // "parsedSequence": { // "features": [ // { // "notes": { // "organism": [ // "Homo sapiens" // ], // "db_xref": [ // "taxon:9606" // ], // "chromosome": [ // "17" // ], // "map": [ // "17q21" // ] // }, // "type": "source", // "strand": 1, // "name": "Homo sapiens", // "start": 0, // "end": 1 // } // ], // "name": "NP_003623", // "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag", // "circular": true, // "extraLines": [ // "DEFINITION contactin-associated protein 1 precursor [Homo sapiens].", // "ACCESSION NP_003623", // "VERSION NP_003623.1 GI:4505463", // "DBSOURCE REFSEQ: accession NM_003632.2", // "KEYWORDS RefSeq." // ], // "type": "DNA", // "size": 925 // } // } // ] ``` You can see more examples by looking at the tests. ## Updating this repo ### Outside collaborators fork and pull request please :) ## Thanks/Collaborators - IsaacLuo - https://github.com/IsaacLuo/SnapGeneFileReader (from which the snapgene parser was adapted) - Joshua Nixon (original collaborator) - Thomas Rich (original collaborator) ====================================================================== @teselagen/file-utils@0.3.23 UNKNOWN https://github.com/TeselaGen/tg-oss # file-utils This library was generated with [Nx](https://nx.dev). ## Building Run `nx build file-utils` to build the library. ## Running unit tests Run `nx test file-utils` to execute the unit tests via [Jest](https://jestjs.io). ====================================================================== @teselagen/ove@0.8.42 UNKNOWN https://github.com/TeselaGen/tg-oss [![openVectorEditor](https://img.shields.io/endpoint?url=https://dashboard.cypress.io/badge/simple/mp89gp/&style=flat&logo=cypress)](https://dashboard.cypress.io/projects/mp89gp/runs) Congrats, you've made it to the repo for Teselagen's Open Source Vector Editor Component - Built With React & Redux - Built for easy extensibility + embed-ibility - Customize the views to suit your needs ![image](https://github.com/TeselaGen/tg-oss/assets/2730609/30c5dbc6-0110-4fef-9f95-79e6bba990d3) ## [CHANGELOG](CHANGELOG.md) ## Demo: https://teselagen.github.io/tg-oss/ove/#/Editor ## Get the desktop app: https://github.com/teselagen/ove-electron#installation-instructions ## Cypress Tests Dashboard: https://dashboard.cypress.io/#/projects/1zj5vc/runs (you'll need to make a login with cypress) ## OVE out in the wild (Who's using OVE): - Teselagen - https://teselagen.com/ (Combinatorial DNA design + Lab management + Ordering + Biohub) - ove-electron - https://github.com/teselagen/ove-electron (Simple desktop plasmid editor a la ApE) - JBEI - https://bioparts.org/ (Auto annotation and blast tool) - JBEI - https://public-registry.jbei.org/ (Lab management and design) - Labii - https://docs.labii.com/widgets/section-widgets/biology/molecular-biology-suite/open-vector-editor (All-in-One Configurable Platform for Scientific Data Management) - eLabFTW - https://www.elabftw.net/ (Open source ELN) - Colabra - https://www.colabra.ai/ (Lab management, ELN, and R&D AI Copilot) [Docs](https://docs.colabra.ai/guide/reference/run-your-experiments/slash-commands/dna-sequences) # Table of Contents - [[CHANGELOG](CHANGELOG.md)](#changelogchangelogmd) - [Demo: https://teselagen.github.io/tg-oss/ove/#/Editor](#demo-httpsteselagengithubiotg-ossoveeditor) - [Get the desktop app: https://github.com/teselagen/ove-electron#installation-instructions](#get-the-desktop-app-httpsgithubcomteselagenove-electroninstallation-instructions) - [Cypress Tests Dashboard: https://dashboard.cypress.io/#/projects/1zj5vc/runs (you'll need to make a login with cypress)](#cypress-tests-dashboard-httpsdashboardcypressioprojects1zj5vcruns-youll-need-to-make-a-login-with-cypress) - [OVE out in the wild (Who's using OVE):](#ove-out-in-the-wild-whos-using-ove) - [Table of Contents](#table-of-contents) - [Upgrade Instructions for Major and Minor Versions](#upgrade-instructions-for-major-and-minor-versions) - [Using this module in React](#using-this-module-in-react) - [Example CRA repo with OVE](#example-cra-repo-with-ove) - [Installation (react)](#installation-react) - [Code (react)](#code-react) - [Editor](#editor) - [SimpleCircularOrLinearView](#simplecircularorlinearview) - [EnzymeViewer](#enzymeviewer) - [Using this module outside of react apps (Universal):](#using-this-module-outside-of-react-apps-universal) - [Installation (Universal)](#installation-universal) - [via npm:](#via-npm) - [Or via CDN:](#or-via-cdn) - [Full Example:](#full-example) - [Code (Universal)](#code-universal) - [Accessing the editor state:](#accessing-the-editor-state) - [Demo (Universal): https://teselagen.github.io/tg-oss/ove/](#demo-universal-httpsteselagengithubiotg-ossove) - [editorProps](#editorprops) - [editorState](#editorstate) - [Setting Local Storage Persisted Values](#setting-local-storage-persisted-values) - [Amino Acid Coloring](#amino-acid-coloring) - [Data Model](#data-model) - [Feature Locations (aka Feature Joins)](#feature-locations-aka-feature-joins) - [Protein Editor](#protein-editor) - [Alignments](#alignments) - [Integrating your own alignment data (only necessary if not using the built in alignment creation tool)](#integrating-your-own-alignment-data-only-necessary-if-not-using-the-built-in-alignment-creation-tool) - [Accessing the alignment state:](#accessing-the-alignment-state) - [Alignment Track Data Model](#alignment-track-data-model) - [Chromatogram Data](#chromatogram-data) - [VersionHistoryView](#versionhistoryview) - [Flavors of use (aka Embedded in the Editor vs Standalone and UMD vs React):](#flavors-of-use-aka-embedded-in-the-editor-vs-standalone-and-umd-vs-react) - [API:](#api) - [getSequenceAtVersion](#getsequenceatversion) - [getVersionList](#getversionlist) - [onSave [optional] (not necessary unless using the standalone VersionHistoryView)](#onsave-optional-not-necessary-unless-using-the-standalone-versionhistoryview) - [exitVersionHistoryView [optional] (not necessary unless using the standalone VersionHistoryView)](#exitversionhistoryview-optional-not-necessary-unless-using-the-standalone-versionhistoryview) - [getCurrentSequenceData [optional] (not necessary unless using the standalone VersionHistoryView)](#getcurrentsequencedata-optional-not-necessary-unless-using-the-standalone-versionhistoryview) - [Addons](#addons) - [Auto annotate addon:](#auto-annotate-addon) - [Implementing Autosave functionality](#implementing-autosave-functionality) - [Development:](#development) - [Prerequisites](#prerequisites) - [Outside Developer Set Up Steps](#outside-developer-set-up-steps) # Upgrade Instructions for Major and Minor Versions This repo follows semantic versioning (major/minor/patche) The commit log can be seen here: https://github.com/TeselaGen/tg-oss/commits/master/packages/ove Upgrade instructions for any major or minor change can be found here: [Upgrade instructions](UPGRADE_INSTRUCTIONS.md) # Using this module in React ## Example repo with OVE Here is where you can see how to run the `` in a Create-React-App environment: https://github.com/tnrich/ove-react-demo-repo If you clone that repo you can see it working and see how to set up the redux store/provider and initialize the editor. You should just clone it and run: ``` yarn yarn start ``` ## Installation (react) ``` yarn add @teselagen/ove react react-dom ``` ## Code (react) Require the following components like: ``` import {Editor, RowView} from "@teselagen/ove" ``` ### Editor To use the `` component, you'll need to do a bit more work to set up a redux store. You can see an example repo where this works here: https://github.com/tnrich/ove-react-demo-repo The `` component gives you a full blown editor. It takes in a list of editorProps as detailed below. ### SimpleCircularOrLinearView This is a non-redux connected component that is easy to use: ```js ``` ### EnzymeViewer A component used for viewing enzymes ```js ``` # Using this module outside of react apps (Universal): The universal build can be used in any app with or without react. It corresponds to using the `` component in the React version. You will be able to customize the Editor just like in the react build, but you will not be able to use the individual components like `` or ``. For that you'll need to use React. ## Installation (Universal) ### via npm: ``` npm install @teselagen/ove ``` then add the links ```html ``` ### Or via CDN: ```html ``` ### Full Example: A full example of how to set up the unpkg/UMD demo can be seen here: https://github.com/TeselaGen/tg-oss/blob/master/packages/ove/public/UMDDemo.html Demo here https://teselagen.github.io/tg-oss/ove/UMDDemo.html ## Code (Universal) ```html ``` ### Accessing the editor state: ```js const currentEditorState = editor.getState(); //you can view various properties of the alignment such as the selection layer using alignment.getState() console.info(currentEditorState.selectionLayer); ``` ## Demo (Universal): https://teselagen.github.io/tg-oss/ove/ # editorProps These props consist of hooks and editor config options that can be passed like so: `` or as seen above like `window.createVectorEditor(yourDomNodeHere, editorProps);` ```js { shouldAutosave: true, //by default the editor does not autosave, setting this to true will trigger the onSave callback after any change to the sequenceData //supplying this function WILL make the editor FULLSCREEN BY DEFAULT handleFullscreenClose: () => { //do whatever you want here //UMD only: editor.close() //this calls reactDom.unmountComponent at the node you passed as the first arg }, onPreviewModeFullscreenClose: () => {}, //user defined handler for tracking when fullscreen is closed from preview mode showReadOnly: false, //default true disableSetReadOnly: true, //default false onSave: function(event, sequenceDataToSave, editorState, onSuccessCallback) { console.info("event:", event); console.info("sequenceData:", sequenceDataToSave); console.info("editorState:", editorState); // To disable the save button after successful saving // either call the onSuccessCallback or return a successful promise :) onSuccessCallback() //or // return myPromiseBasedApiCall() }, onCopy: function(event, copiedSequenceData, editorState) { //the copiedSequenceData is the subset of the sequence that has been copied in the teselagen sequence format console.info("event:", event); console.info("sequenceData:", copiedSequenceData); console.info("editorState:", editorState); const clipboardData = event.clipboardData; clipboardData.setData( "application/json", JSON.stringify(copiedSequenceData) ); event.preventDefault(); //in onPaste in your app you can do: // e.clipboardData.getData('application/json') }, onPaste: function(event, editorState) { //the onPaste here must return sequenceData in the teselagen data format const clipboardData = event.clipboardData; let jsonData = clipboardData.getData("application/json") if (jsonData) { jsonData = JSON.parse(jsonData) if (jsonData.isJbeiSeq) { jsonData = convertJbeiToTeselagen(jsonData) } } const sequenceData = jsonData || {sequence: clipboardData.getData("text/plain")} return sequenceData }, beforeAnnotationCreate: ({ //also works for edits (!) annotationTypePlural, //features/parts/primers annotation, //annotation info props, //general props to the dialog isEdit //true if this is an edit instead of a create }) => { //a handler to hook into when annotations (features/primers/parts) are being created }, //regular click overrides, eg: featureClicked: ({annotation, event}) => { //do something here :) } // orf/primer/translation/cutsite/translationDouble/deletionLayer/replacementLayer/feature/part/searchLayer xxxxClicked can also be overridden rightClickOverrides: { //override what happens when a given feature/part/primer/translation/orf/cutsite/selectionLayer/lineageLine gets right clicked //the general format is xxxxRightClicked eg: selectionLayerRightClicked: (items, {annotation}, props) => { return [...items, { //props here get passed directly to blueprintjs MenuItems text: "Create Part", onClick: () => console.info('hey!≈') }] } }, PropertiesProps: { // the list of tabs shown in the Properties panel propertiesList: [ "general", "features", "parts", "primers", "translations", "cutsites", "orfs", "genbank" ] }, ToolBarProps: { toolList: [ "saveTool", //you can override a tool like so: {name: "downloadTool", Dropdown: () => { return "Hey!" }}, "importTool", "undoTool", "redoTool", "cutsiteTool", "featureTool", "alignmentTool", // "oligoTool", "orfTool", // "viewTool", "editTool", "findTool", "visibilityTool" // "propertiesTool" ] } StatusBarProps: { //these are the defaults: showCircularity: true, showReadOnly: true, showAvailability: false }, onDigestSave: () => {} //tnr: NOT YET IMPLEMENTED } ``` # editorState These are the options to the `updateEditor()` action (the most generic redux action we have)) and will cause the editor state stored in redux to be updated. Only the subset of options that are passed will be updated. ```js { //note, sequence data passed here will be coerced to fit the Teselagen data model (Teselagen JSON) sequenceData: { //Open Vector Editor data model -- https://github.com/TeselaGen/ve-sequence-parsers#format-specification sequence: "atagatagagaggcccg", features: [ { color: "#b3b3b3", //you can override the default color for each individual feature if you want type: "misc_feature", start: 0, //start and end are 0-based inclusive for all annotations end: 10, id: 'yourUniqueID', forward: true //ie true=positive strand false=negative strange } ], parts: [] }, sequenceDataHistory: {}, //clear the sequenceDataHistory if there is any left over from a previous sequence sequenceDataHistory: {}, //clear the sequenceDataHistory if there is any left over from a previous sequence annotationVisibility: { features: false }, panelsShown: [ [ { id: "sequence", name: "Sequence Map", active: true } ], [ { id: "circular", name: "Circular Map", active: true }, { id: "rail", name: "Linear Map", active: false }, { id: "properties", name: "Properties", active: false } ] ], caretPosition: 10, ...additional editor props can be passed here [Example Editor State](./editorStateExample.js) } ``` # Setting Local Storage Persisted Values ### Amino Acid Coloring ```js localStorage.setItem("aaColorType", localStorage.getItem("aaColorType") || "byFamily"); ``` # Data Model The data model can be interactively inspected by installing the redux devtools for your browser: [devtools](https://chrome.google.com/webstore/detail/redux-devtools/lmhkpmbekcpmknklioeibfkpmmfibljd?hl=en) Here is the top level editor state: [Example Editor State](./editorStateExample.js) ## Feature Locations (aka Feature Joins) Features can have multiple internal locations. You can see an example of a joined feature in the ./editorStateExample.js file linked above. They look like this: ```js { name: "GFP_with_locations" start: 10, end: 40, locations: [{ start: 10, //this must match the .start property of the feature, end: 15 }, { start: 18, end: 19 }, { start: 35, end: 40 //this must match the .end property of the feature, } ] } ``` # Protein Editor OVE can be set up to view and edit proteins (Amino Acid sequences) as first class citizens. The protein editor can be seen here: https://teselagen.github.io/tg-oss/ove/#/Editor?moleculeType=Protein The editor supports Amino Acid sequences as well as DNA sequences! Protein sequence mode is enabled by calling updateEditor with a protein sequenceData object: ```js updateEditor(store, "DemoEditor", { sequenceData: tidyUpSequenceData(exampleProteinData, { convertAnnotationsFromAAIndices: true }) }); ``` the protein sequenceData object should look like so ```js { isProtein: true //either or both .proteinSequence (aa string) or .sequence (dna string) must be provided if isProtein: true //if only .sequence is provided, OVE will automatically compute the amino acids from the provided dna sequence //if only .proteinSequence is provided, OVE will automatically compute the degenerate DNA sequence from the provided aa string //if both .proteinSequence and .sequence are provided, then OVE will assume that the underlying //dna sequence maps to the provided aa string as long as sequence.length === 3 * proteinSequence.length proteinSequence: "mmhlrlfcillaavs...etc" sequence: "gtagagagagcca...etc" //optional! //if features or parts are provided to the editor, it is assumed that they will indexed to the underlying DNA sequence (0-based inclusive) , not to the AA indices . //You can use the helper util from @teselagen/sequence-utils tidyUpSequenceData to convertAnnotationsFromAAIndices if your protein data has //features/parts coming in as AA-indexed features: [{name: "testFeature1", start: 3, //start on AA 1 end: 5 //end on AA 1 }], parts: [{ name: "myFakePart" start: 0, //start on AA 0 end: 11 //end on AA 3 }] } ``` The usual onSave, onCopy, onCut handlers will now come back with a .proteinSequence field. You'll need to save/manipulate the protein sequence data however you do for dna sequences. certain dna specific tools and annotations are automatically disabled when isProtein=true : - primers - orfs - translations - cutsites - sequence digestions - ...etc # Alignments ## Integrating your own alignment data (only necessary if not using the built in alignment creation tool) Add a panel to the panelsShown prop like so: ```js const alignment = window.createAlignmentView(this.node, { id: "jbeiAlignment1", //give your alignment a unique id ////optional! Use if you want a pairwise alignment: pairwiseAlignments: [ // this is an array of [referenceSequence, alignedSequence] [ { //reference sequence must come first! sequenceData: { id: "FWER1231", //every sequenceData and alignmentData should have a unique id name: "GFPuv58", sequence: "ttgagggg", features: [{id: "feat1", start: 2, end:4, name: "GFP CDS"}] }, alignmentData: { sequence: "ttgag--ggg--" //this length should be the same as the below alignmentData length! } },{ //aligned sequence must come second! sequenceData: { name: "GFPuv58", sequence: "gagccgggtt" }, alignmentData: { sequence: "--gagccgggtt" //this length should be the same as the above alignmentData length! } } ] [ {Alignment Track Data Here}, //reference sequence track (see Data Model below for specs) {Alignment Track Data Here}, //aligned sequence track (see Data Model below for specs) ], [ {Alignment Track Data Here}, //see Data Model below for specs {Alignment Track Data Here}, ], ] ////optional! Use if you want a multi-seq alignment: alignmentTracks: [ {Alignment Track Data Here}, //see Data Model below for specs {Alignment Track Data Here}, {Alignment Track Data Here}, ], //additional view options: "alignmentAnnotationVisibility": { "features": true, "translations": false, "parts": true, "orfs": true, "orfTranslations": false, "axis": true, "cutsites": false, "primers": true, "reverseSequence": false, "fivePrimeThreePrimeHints": true, "axisNumbers": true }, "alignmentAnnotationLabelVisibility": { "features": true, "parts": true, "cutsites": false }, }); ``` ### Accessing the alignment state: ```js const currentAlignmentState = alignment.getState(); //you can view various properties of the alignment such as the selection layer using alignment.getState() console.info(currentAlignmentState.selectionLayer); ``` ## Alignment Track Data Model Note: `alignmentData.sequence` is assumed to be the same length for EVERY track within an alignment run or a pairwise alignment sub-alignment! `alignmentData` can contain "-" characters, whereas sequenceData should not. Sequence Data is the "raw" data of the sequence being aligned with features/parts/etc. ```js { //JBEI sequence 'GFPuv58' // chromatogramData: ab1ParsedGFPuv58, sequenceData: { id: "2", name: "GFPuv58", sequence: "GTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTT" }, alignmentData: { id: "2", sequence: "GTTCAA--TGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACA---GGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATAC--CCTTGTTAATCGTATCGAGTT--" } } ``` ### Chromatogram Data ``` "chromatogramData": { //only if parsing in an ab1 file "aTrace": [], //same as cTrace but for a "tTrace": [], //same as cTrace but for t "gTrace": [], //same as cTrace but for g "cTrace": [0,0,0,1,3,5,11,24,56,68,54,30,21,3,1,4,1,0,0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000) "basePos": [33, 46, 55,], //x position of the bases (can be unevenly spaced) "baseCalls": ["A","T", ...etc], "qualNums": [], //or undefined if no qualNums are detected on the file }, ``` # VersionHistoryView ## Flavors of use (aka Embedded in the Editor vs Standalone and UMD vs React): Can be used on its own (must pass additional props): ```js ; //or as a UMD module: window.createVersionHistoryView({ getSequenceAtVersion, getVersionList, onSave, exitVersionHistoryView, getCurrentSequenceData }); ``` or as part of the Editor/createVectorEditor ```js ; //or as a UMD module: window.createVectorEditor({ getSequenceAtVersion, getVersionList, onSave, ToolBarProps: { toolList: ["versionHistoryTool", ...otherTools] } }); ``` ## API: #### getSequenceAtVersion `(versionId) => teselagenSequenceData` #### getVersionList `() => [{ versionId: "51241", dateChanged: "12/30/1990", editedBy: "Hector Plahar", revisionType: "Feature Add"}]` #### onSave [optional] (not necessary unless using the standalone VersionHistoryView) `(event, sequenceDataToSave, editorState, onSuccessCallback) => { same onSave handler as normal } ` #### exitVersionHistoryView [optional] (not necessary unless using the standalone VersionHistoryView) `() => {} ` #### getCurrentSequenceData [optional] (not necessary unless using the standalone VersionHistoryView) `() => teselagenSequenceData //called upon initialization ` # Addons ## Auto annotate addon: https://github.com/TeselaGen/tg-oss/blob/master/packages/ove/src/AutoAnnotate.js # Implementing Autosave functionality pass shouldAutosave=true as a prop and in the onSave() handler, make sure to return a promise so that the UI responds correctly with a spinner indicating saving is in progress # Development: ## Prerequisites [Node.js](http://nodejs.org/) >= v8 must be installed. download the latest yarn ## Outside Developer Set Up Steps ``` IMPORTANT! First make sure you make an issue for whatever it is you'd like to see changed! fork your own branch of tg-oss from https://github.com/TeselaGen/tg-oss cd tg-oss yarn yarn nx run ove:start #this will start the demo app navigate to the output url (usually http://127.0.0.1:8805) ``` modify the tg-oss code base to fix/build whatever it is you're trying to do set up a demo for your fix/feature if applicable in demo/src/EditorDemo/index.js set up a cypress test for your fix/feature if applicable you can run the cypress dev tool by running ``` yarn nx run ove:launch-e2e #this will run the cypress tests ``` you can view existing cypress tests in the packages/ove/cypress/e2e folder you can either add your test to an existing cypress file or make a new test file once you're satisfied, make a pull request back to tg-oss and mention @tnrich ## Running unit tests Run `bun test` from the root of the repo to execute all unit tests. ====================================================================== @teselagen/range-utils@0.3.20 UNKNOWN https://github.com/TeselaGen/tg-oss - [[CHANGELOG](Changelog.md)](#changelogchangelogmd) - [Installing](#installing) - [Usage](#usage) - [About this Repo](#about-this-repo) - [Editing This Repo:](#editing-this-repo) - [All collaborators:](#all-collaborators) - [Updating this repo:](#updating-this-repo) - [Teselagen collaborators:](#teselagen-collaborators) - [Outside collaborators:](#outside-collaborators) - [Building](#building) - [Running unit tests](#running-unit-tests) ## [CHANGELOG](Changelog.md) ## Installing ``` npm install @teselagen/range-utils ``` ## Usage ``` import { getRangeLength } from '@teselagen/range-utils'; ``` ## About this Repo This is a collection of range utility functions. A range must be an object with a start and end property. Eg: ``` const myRange = { start: 10, end: 40 } ``` A "circular" range has a start > end. Eg: ``` const myRange2 = { start: 50, end: 40 } ``` All ranges are assumed to have 0-based inclusive indices: rrrr 0123 start = 0, end = 3 ## Editing This Repo: ### All collaborators: Edit/create a new file and update/add any relevant tests. You can run `npm test` to make sure all tests pass. Tests will automatically be run pre-commit. ## Updating this repo: ### Outside collaborators: fork and pull request please :) This library was generated with [Nx](https://nx.dev). ## Building Run `nx build range-utils` to build the library. ## Running unit tests Run `nx test range-utils` to execute the unit tests via [Jest](https://jestjs.io). ====================================================================== @teselagen/react-list@0.8.18 MIT https://github.com/coderiety/react-list The MIT License (MIT) Copyright (c) 2017 Casey Foster Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @teselagen/react-table@6.10.18 MIT https://github.com/tnrich/react-table MIT License Copyright (c) 2016 Tanner Linsley Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @teselagen/sequence-utils@0.3.42 UNKNOWN https://github.com/TeselaGen/tg-oss - [[CHANGELOG](CHANGELOG.md)](#changelogchangelogmd) - [Installing](#installing) - [Usage](#usage) - [About this Repo](#about-this-repo) - [Editing This Repo:](#editing-this-repo) - [All collaborators:](#all-collaborators) - [Updating this repo:](#updating-this-repo) - [Teselagen collaborators:](#teselagen-collaborators) - [Outside collaborators:](#outside-collaborators) - [Building](#building) - [Running unit tests](#running-unit-tests) ## [CHANGELOG](CHANGELOG.md) ## Installing ``` npm install @teselagen/sequence-utils ``` ## Usage ``` import { getComplementSequence } from '@teselagen/sequence-utils'; const mySequence = 'ATGAGAG'; const myComplement = getComplementSequence(mySequence); console.log(myComplement); // TACTCTC ``` ## About this Repo This is a collection of dna sequence utility functions. All sequences and annotations (unless otherwise specified) are assumed to have 0-based inclusive indices. ``` Example: 0123456 ATGAGAG --fff-- (the feature covers GAG) 0-based inclusive start: feature.start = 2 1-based inclusive start: feature.start = 3 0-based inclusive end: feature.end = 4 1-based inclusive end: feature.end = 5 ``` ## Editing This Repo: ### All collaborators: Edit/create a new file and update/add any relevant tests. Make sure they pass by running `npm test` ## Updating this repo: Commit and push all changes first (make sure tests are passing!) # Publishing See the [README](../README.md) ### Outside collaborators: fork and pull request please :) This library was generated with [Nx](https://nx.dev). ## Building Run `nx build sequence-utils` to build the library. ## Running unit tests Run `nx test sequence-utils` to execute the unit tests via [Jest](https://jestjs.io). ====================================================================== @teselagen/ui@0.10.20 UNKNOWN https://github.com/TeselaGen/tg-oss # ui This library was generated with [Nx](https://nx.dev). ## Running unit tests Run `bun test` from the root of the repo to execute all unit tests. ## Running end-to-end tests locally Run `nx run ui:launch-e2e` to launch the Cypress test runner locally ## Installation (react) ``` yarn add @teselagen/ui react react-dom ``` ## Running locally ``` nx run ui:start ``` ====================================================================== @types/debug@4.1.13 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/dom4@2.0.4 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/estree-jsx@1.0.5 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/estree@1.0.9 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/hast@3.0.5 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/hoist-non-react-statics@3.3.7 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/mdast@4.0.4 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/ms@2.1.0 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/prop-types@15.7.15 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/react@18.3.31 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/unist@2.0.11 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/unist@3.0.3 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @types/use-sync-external-store@0.0.3 MIT https://github.com/DefinitelyTyped/DefinitelyTyped MIT License Copyright (c) Microsoft Corporation. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE ====================================================================== @ungap/structured-clone@1.4.0 ISC https://github.com/ungap/structured-clone ISC License Copyright (c) 2021, Andrea Giammarchi, @WebReflection Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== @use-gesture/core@10.3.0 MIT https://github.com/pmndrs/use-gesture Copyright (c) 2018-present Paul Henschel Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== @use-gesture/react@10.3.0 MIT https://github.com/pmndrs/use-gesture Copyright (c) 2018-present Paul Henschel Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== abbrev@2.0.0 ISC https://github.com/npm/abbrev-js This software is dual-licensed under the ISC and MIT licenses. You may use this software under EITHER of the following licenses. ---------- The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ---------- Copyright Isaac Z. Schlueter and Contributors All rights reserved. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ansi-regex@5.0.1 MIT https://github.com/chalk/ansi-regex MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ansi-regex@6.3.0 MIT https://github.com/chalk/ansi-regex MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ansi-styles@4.3.0 MIT https://github.com/chalk/ansi-styles MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ansi-styles@6.2.3 MIT https://github.com/chalk/ansi-styles MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== archiver-utils@2.1.0 MIT https://github.com/archiverjs/archiver-utils Copyright (c) 2015 Chris Talkington. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== archiver-utils@3.0.4 MIT https://github.com/archiverjs/archiver-utils Copyright (c) 2015 Chris Talkington. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== archiver@5.3.2 MIT https://github.com/archiverjs/node-archiver Copyright (c) 2012-2014 Chris Talkington, contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== array-find-index@1.0.2 MIT https://github.com/sindresorhus/array-find-index The MIT License (MIT) Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== async@3.2.6 MIT https://github.com/caolan/async Copyright (c) 2010-2018 Caolan McMahon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== attr-accept@2.2.5 MIT https://github.com/react-dropzone/attr-accept The MIT License (MIT) Copyright (c) 2015 Andrey Okonetchnikov Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== bail@2.0.2 MIT https://github.com/wooorm/bail (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== balanced-match@1.0.2 MIT https://github.com/juliangruber/balanced-match (MIT) Copyright (c) 2013 Julian Gruber <julian@juliangruber.com> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== base64-arraybuffer@1.0.2 MIT https://github.com/niklasvh/base64-arraybuffer Copyright (c) 2012 Niklas von Hertzen Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== base64-js@1.5.1 MIT https://github.com/beatgammit/base64-js The MIT License (MIT) Copyright (c) 2014 Jameson Little Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== batch-processor@1.0.0 MIT https://github.com/wnr/batch-processor The MIT License (MIT) Copyright (c) 2015 Lucas Wiener Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== bl@4.1.0 MIT https://github.com/rvagg/bl The MIT License (MIT) ===================== Copyright (c) 2013-2019 bl contributors ---------------------------------- *bl contributors listed at * Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== brace-expansion@1.1.21 MIT https://github.com/juliangruber/brace-expansion MIT License Copyright (c) 2013 Julian Gruber Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== brace-expansion@2.1.7 MIT https://github.com/juliangruber/brace-expansion MIT License Copyright (c) 2013 Julian Gruber Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== buffer-crc32@0.2.13 MIT https://github.com/brianloveswords/buffer-crc32 The MIT License Copyright (c) 2013 Brian J. Brennan Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== buffer@5.7.1 MIT https://github.com/feross/buffer The MIT License (MIT) Copyright (c) Feross Aboukhadijeh, and other contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== bufferpack@0.0.6 BSD* https://github.com/ryanrolds/bufferpack Copyright (c) 2008, Fair Oaks Labs, Inc. All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of Fair Oaks Labs, Inc. nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ====================================================================== call-bind-apply-helpers@1.0.2 MIT https://github.com/ljharb/call-bind-apply-helpers MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== call-bind@1.0.9 MIT https://github.com/ljharb/call-bind MIT License Copyright (c) 2020 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== call-bound@1.0.4 MIT https://github.com/ljharb/call-bound MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ccount@2.0.1 MIT https://github.com/wooorm/ccount (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== chalk@4.1.2 MIT https://github.com/chalk/chalk MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== change-emitter@0.1.6 MIT https://github.com/acdlite/change-emitter change-emitter ============== [![build status](https://img.shields.io/travis/acdlite/change-emitter/master.svg?style=flat-square)](https://travis-ci.org/acdlite/change-emitter) [![npm version](https://img.shields.io/npm/v/change-emitter.svg?style=flat-square)](https://www.npmjs.com/package/change-emitter) Listen for changes. Like an event emitter that only emits a single event type. Really tiny. I extracted this from Redux's `createStore()` because I found it to be useful in other contexts. Use it where you want the most minimal event subscription implementation possible. ## Usage ```js import { createChangeEmitter } from 'change-emitter' const emitter = createChangeEmitter() // Called `listen` instead of `subscribe` to avoid confusion with observable spec const unlisten = emitter.listen((...args) => { console.log(args) }) emitter.emit(1, 2, 3) // logs `[1, 2, 3]` unlisten() emitter.emit(4, 5, 6) // doesn't log ``` ## Larger example Here's a (partial) implementation of Redux's `createStore`: ```js const createStore = (reducer, initialState) => { let state = initialState const emitter = createChangeEmitter() function dispatch(action) { state = reducer(state, action) emitter.emit() return action } function getState() { return state } return { dispatch, getState, subscribe: emitter.listen } } ``` ====================================================================== character-entities-html4@2.1.0 MIT https://github.com/wooorm/character-entities-html4 (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== character-entities-legacy@3.0.0 MIT https://github.com/wooorm/character-entities-legacy (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== character-entities@2.0.2 MIT https://github.com/wooorm/character-entities (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== character-reference-invalid@2.0.1 MIT https://github.com/wooorm/character-reference-invalid (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== classnames@2.5.1 MIT https://github.com/JedWatson/classnames The MIT License (MIT) Copyright (c) 2018 Jed Watson Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== clipboard@2.0.11 MIT https://github.com/zenorocha/clipboard.js MIT License Copyright (c) Zeno Rocha Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== clsx@1.2.1 MIT https://github.com/lukeed/clsx MIT License Copyright (c) Luke Edwards (lukeed.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== clsx@2.1.1 MIT https://github.com/lukeed/clsx MIT License Copyright (c) Luke Edwards (lukeed.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== color-convert@1.9.3 MIT https://github.com/Qix-/color-convert Copyright (c) 2011-2016 Heather Arthur Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== color-convert@2.0.1 MIT https://github.com/Qix-/color-convert Copyright (c) 2011-2016 Heather Arthur Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== color-name@1.1.3 MIT https://github.com/dfcreative/color-name The MIT License (MIT) Copyright (c) 2015 Dmitry Ivanov Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== color-name@1.1.4 MIT https://github.com/colorjs/color-name The MIT License (MIT) Copyright (c) 2015 Dmitry Ivanov Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== color-string@1.9.1 MIT https://github.com/Qix-/color-string Copyright (c) 2011 Heather Arthur Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== color@3.2.1 MIT https://github.com/Qix-/color Copyright (c) 2012 Heather Arthur Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== combokeys@3.0.1 Apache-2.0* https://github.com/PolicyStat/combokeys Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "[]" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright [yyyy] [name of copyright owner] Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== comma-separated-tokens@2.0.3 MIT https://github.com/wooorm/comma-separated-tokens (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== compress-commons@4.1.2 MIT https://github.com/archiverjs/node-compress-commons Copyright (c) 2014 Chris Talkington, contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== concat-map@0.0.1 MIT https://github.com/substack/node-concat-map This software is released under the MIT license: Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== copy-to-clipboard@3.3.3 MIT https://github.com/sudodoki/copy-to-clipboard MIT License Copyright (c) 2017 sudodoki Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== core-util-is@1.0.3 MIT https://github.com/isaacs/core-util-is Copyright Node.js contributors. All rights reserved. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== crc-32@1.2.2 Apache-2.0 https://github.com/SheetJS/js-crc32 Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "{}" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright (C) 2014-present SheetJS LLC Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== crc32-stream@4.0.3 MIT https://github.com/archiverjs/node-crc32-stream Copyright (c) 2014 Chris Talkington, contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== cross-spawn@7.0.6 MIT https://github.com/moxystudio/node-cross-spawn The MIT License (MIT) Copyright (c) 2018 Made With MOXY Lda Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== css-box-model@1.2.1 MIT https://github.com/alexreardon/css-box-model MIT License Copyright (c) 2018 Alex Reardon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== css-line-break@2.1.0 MIT https://github.com/niklasvh/css-line-break Copyright (c) 2017 Niklas von Hertzen Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== csstype@3.2.3 MIT https://github.com/frenic/csstype Copyright (c) 2017-2018 Fredrik Nicol Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== dayjs@1.11.23 MIT https://github.com/iamkun/dayjs MIT License Copyright (c) 2018-present, iamkun Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== debug@4.4.3 MIT https://github.com/debug-js/debug (The MIT License) Copyright (c) 2014-2017 TJ Holowaychuk Copyright (c) 2018-2021 Josh Junon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== decode-named-character-reference@1.3.0 MIT https://github.com/wooorm/decode-named-character-reference (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== deep-equal@1.1.2 MIT https://github.com/inspect-js/node-deep-equal MIT License Copyright (c) 2012, 2013, 2014 James Halliday , 2009 Thomas Robinson <280north.com> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== define-data-property@1.1.4 MIT https://github.com/ljharb/define-data-property MIT License Copyright (c) 2023 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== define-properties@1.2.1 MIT https://github.com/ljharb/define-properties The MIT License (MIT) Copyright (C) 2015 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== delegate@3.2.0 MIT https://github.com/zenorocha/delegate # delegate Lightweight event delegation. ## Install You can get it on npm. ``` npm install delegate --save ``` If you're not into package management, just [download a ZIP](https://github.com/zenorocha/delegate/archive/master.zip) file. ## Setup ###### Node (Browserify) ```js var delegate = require('delegate'); ``` ###### Browser (Standalone) ```html ``` ## Usage ### Add event delegation #### With the default base (`document`) ```js delegate('.btn', 'click', function(e) { console.log(e.delegateTarget); }, false); ``` #### With an element as base ```js delegate(document.body, '.btn', 'click', function(e) { console.log(e.delegateTarget); }, false); ``` #### With a selector (of existing elements) as base ```js delegate('.container', '.btn', 'click', function(e) { console.log(e.delegateTarget); }, false); ``` #### With an array/array-like of elements as base ```js delegate(document.querySelectorAll('.container'), '.btn', 'click', function(e) { console.log(e.delegateTarget); }, false); ``` ### Remove event delegation #### With a single base element (default or specified) ```js var delegation = delegate(document.body, '.btn', 'click', function(e) { console.log(e.delegateTarget); }, false); delegation.destroy(); ``` #### With multiple elements (via selector or array) Note: selectors are always treated as multiple elements, even if one or none are matched. `delegate()` will return an array. ```js var delegations = delegate('.container', '.btn', 'click', function(e) { console.log(e.delegateTarget); }, false); delegations.forEach(function (delegation) { delegation.destroy(); }); ``` ## Browser Support | Chrome logo | Edge logo | Firefox logo | Internet Explorer logo | Opera logo | Safari logo | |:---:|:---:|:---:|:---:|:---:|:---:| | Latest ✔ | Latest ✔ | Latest ✔ | 9+ ✔ | Latest ✔ | Latest ✔ | ## License [MIT License](http://zenorocha.mit-license.org/) © Zeno Rocha ====================================================================== dequal@2.0.3 MIT https://github.com/lukeed/dequal The MIT License (MIT) Copyright (c) Luke Edwards (lukeed.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== devlop@1.1.0 MIT https://github.com/wooorm/devlop (The MIT License) Copyright (c) 2023 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== dom-helpers@3.4.0 MIT https://github.com/jquense/dom-helpers The MIT License (MIT) Copyright (c) 2015 Jason Quense Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== dom-scroll-into-view@2.0.1 MIT https://github.com/yiminghe/dom-scroll-into-view # dom-scroll-into-view --- scroll node in contain to make node visible [![NPM version][npm-image]][npm-url] [![npm download][download-image]][download-url] [npm-image]: http://img.shields.io/npm/v/dom-scroll-into-view.svg?style=flat-square [npm-url]: http://npmjs.org/package/dom-scroll-into-view [travis-image]: https://img.shields.io/travis/react-component/dom-scroll-into-view.svg?style=flat-square [travis-url]: https://travis-ci.org/react-component/dom-scroll-into-view [coveralls-image]: https://img.shields.io/coveralls/react-component/dom-scroll-into-view.svg?style=flat-square [coveralls-url]: https://coveralls.io/r/react-component/dom-scroll-into-view?branch=master [gemnasium-image]: http://img.shields.io/gemnasium/react-component/dom-scroll-into-view.svg?style=flat-square [gemnasium-url]: https://gemnasium.com/react-component/dom-scroll-into-view [node-image]: https://img.shields.io/badge/node.js-%3E=_0.10-green.svg?style=flat-square [node-url]: http://nodejs.org/download/ [download-image]: https://img.shields.io/npm/dm/dom-scroll-into-view.svg?style=flat-square [download-url]: https://npmjs.org/package/dom-scroll-into-view ## install [![dom-scroll-into-view](https://nodei.co/npm/dom-scroll-into-view.png)](https://npmjs.org/package/dom-scroll-into-view) ## Usage ```js import scrollIntoView from 'dom-scroll-into-view'; scrollIntoView(source,container,config); ``` ## Development ``` npm install npm start ``` ## Example http://localhost:8000/examples/ online example: http://yiminghe.github.io/dom-scroll-into-view/ ## function parameter
name type default description
source HTMLElement node wanted to show
container HTMLElement
config.alignWithLeft Boolean whether align with left edge
config.alignWithTop Boolean whether align with top edge
config.offsetTop Number
config.offsetLeft Number
config.offsetBottom Number
config.offsetRight Number
config.allowHorizontalScroll Boolean whether allow horizontal scroll container
config.onlyScrollIfNeeded Boolean whether scroll container when source is visible
## License dom-scroll-into-view is released under the MIT license. ====================================================================== dom-to-image@2.6.0 MIT https://github.com/tsayen/dom-to-image The MIT License (MIT) Copyright 2015 Anatolii Saienko https://github.com/tsayen Copyright 2012 Paul Bakaus http://paulbakaus.com/ Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== dom4@2.1.6 MIT https://github.com/WebReflection/dom4 Copyright (C) 2013-2015 by Andrea Giammarchi - @WebReflection Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== downloadjs@1.4.7 MIT https://github.com/rndme/download MIT License Copyright (c) 2016 dandavis Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== dunder-proto@1.0.1 MIT https://github.com/es-shims/dunder-proto MIT License Copyright (c) 2024 ECMAScript Shims Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== eastasianwidth@0.2.0 MIT https://github.com/komagata/eastasianwidth # East Asian Width Get [East Asian Width](http://www.unicode.org/reports/tr11/) from a character. 'F'(Fullwidth), 'H'(Halfwidth), 'W'(Wide), 'Na'(Narrow), 'A'(Ambiguous) or 'N'(Natural). Original Code is [東アジアの文字幅 (East Asian Width) の判定 - 中途](http://d.hatena.ne.jp/takenspc/20111126#1322252878). ## Install $ npm install eastasianwidth ## Usage var eaw = require('eastasianwidth'); console.log(eaw.eastAsianWidth('￦')) // 'F' console.log(eaw.eastAsianWidth('｡')) // 'H' console.log(eaw.eastAsianWidth('뀀')) // 'W' console.log(eaw.eastAsianWidth('a')) // 'Na' console.log(eaw.eastAsianWidth('①')) // 'A' console.log(eaw.eastAsianWidth('ف')) // 'N' console.log(eaw.characterLength('￦')) // 2 console.log(eaw.characterLength('｡')) // 1 console.log(eaw.characterLength('뀀')) // 2 console.log(eaw.characterLength('a')) // 1 console.log(eaw.characterLength('①')) // 2 console.log(eaw.characterLength('ف')) // 1 console.log(eaw.length('あいうえお')) // 10 console.log(eaw.length('abcdefg')) // 7 console.log(eaw.length('￠￦｡ￜㄅ뀀¢⟭a⊙①بف')) // 19 ====================================================================== element-resize-detector@1.2.4 MIT https://github.com/wnr/element-resize-detector The MIT License (MIT) Copyright (c) 2016 Lucas Wiener Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== emoji-regex@8.0.0 MIT https://github.com/mathiasbynens/emoji-regex Copyright Mathias Bynens Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== emoji-regex@9.2.2 MIT https://github.com/mathiasbynens/emoji-regex Copyright Mathias Bynens Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== end-of-stream@1.4.5 MIT https://github.com/mafintosh/end-of-stream The MIT License (MIT) Copyright (c) 2014 Mathias Buus Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== es-define-property@1.0.1 MIT https://github.com/ljharb/es-define-property MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== es-errors@1.3.0 MIT https://github.com/ljharb/es-errors MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== es-object-atoms@1.1.2 MIT https://github.com/ljharb/es-object-atoms MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== es6-error@4.1.1 MIT https://github.com/bjyoungblood/es6-error The MIT License (MIT) Copyright (c) 2015 Ben Youngblood Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== escape-string-regexp@5.0.0 MIT https://github.com/sindresorhus/escape-string-regexp MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== estree-util-is-identifier-name@3.0.0 MIT https://github.com/syntax-tree/estree-util-is-identifier-name (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== extend@3.0.2 MIT https://github.com/justmoon/node-extend The MIT License (MIT) Copyright (c) 2014 Stefan Thomas Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== fast-xml-parser@4.5.7 MIT https://github.com/NaturalIntelligence/fast-xml-parser MIT License Copyright (c) 2017 Amit Kumar Gupta Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== fflate@0.8.3 MIT https://github.com/101arrowz/fflate MIT License Copyright (c) 2026 Arjun Barrett Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== file-saver@2.0.5 MIT https://github.com/eligrey/FileSaver.js The MIT License Copyright © 2016 [Eli Grey][1]. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. [1]: http://eligrey.com ====================================================================== file-selector@0.4.0 MIT https://github.com/react-dropzone/file-selector MIT License Copyright (c) 2020 Roland Groza Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== foreground-child@3.3.1 ISC https://github.com/tapjs/foreground-child The ISC License Copyright (c) 2015-2023 Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== fs-constants@1.0.0 MIT https://github.com/mafintosh/fs-constants The MIT License (MIT) Copyright (c) 2018 Mathias Buus Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== fs.realpath@1.0.0 ISC https://github.com/isaacs/fs.realpath The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ---- This library bundles a version of the `fs.realpath` and `fs.realpathSync` methods from Node.js v0.10 under the terms of the Node.js MIT license. Node's license follows, also included at the header of `old.js` which contains the licensed code: Copyright Joyent, Inc. and other Node contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== function-bind@1.1.2 MIT https://github.com/Raynos/function-bind Copyright (c) 2013 Raynos. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== functions-have-names@1.2.3 MIT https://github.com/inspect-js/functions-have-names MIT License Copyright (c) 2019 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== fuse.js@6.6.2 Apache-2.0 https://github.com/krisk/Fuse Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "{}" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright 2017 Kirollos Risk Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== fuzzysearch@1.0.3 MIT https://github.com/bevacqua/fuzzysearch The MIT License (MIT) Copyright © 2015 Nicolas Bevacqua Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== get-intrinsic@1.3.0 MIT https://github.com/ljharb/get-intrinsic MIT License Copyright (c) 2020 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== get-node-dimensions@1.2.1 MIT https://github.com/souporserious/get-node-dimensions The MIT License (MIT) Copyright (c) 2015 get-node-dimensions authors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== get-proto@1.0.1 MIT https://github.com/ljharb/get-proto MIT License Copyright (c) 2025 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== glob@10.5.0 ISC https://github.com/isaacs/node-glob The ISC License Copyright (c) 2009-2023 Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== glob@7.2.3 ISC https://github.com/isaacs/node-glob The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ## Glob Logo Glob's logo created by Tanya Brassie , licensed under a Creative Commons Attribution-ShareAlike 4.0 International License https://creativecommons.org/licenses/by-sa/4.0/ ====================================================================== good-listener@1.2.2 MIT https://github.com/zenorocha/good-listener # good-listener [![Build Status](http://img.shields.io/travis/zenorocha/good-listener/master.svg?style=flat)](https://travis-ci.org/zenorocha/good-listener) > A more versatile way of adding & removing event listeners. ![good listener](https://cloud.githubusercontent.com/assets/398893/10718224/dfc25f6c-7b2a-11e5-9d3d-75b35e8603c8.jpg) ## Install You can get it on npm. ``` npm install good-listener --save ``` Or bower, too. ``` bower install good-listener --save ``` If you're not into package management, just [download a ZIP](https://github.com/zenorocha/good-listener/archive/master.zip) file. ## Setup ###### Node (Browserify) ```js var listen = require('good-listener'); ``` ###### Browser (Standalone) ```html ``` ## Usage ### Add an event listener By passing a string selector [(see full demo)](https://github.com/zenorocha/good-listener/blob/master/demo/selector.html). ```js listen('.btn', 'click', function(e) { console.log(e); }); ``` Or by passing a HTML element [(see full demo)](https://github.com/zenorocha/good-listener/blob/master/demo/node.html). ```js var logo = document.getElementById('logo'); listen(logo, 'click', function(e) { console.log(e); }); ``` Or by passing a list of HTML elements [(see full demo)](https://github.com/zenorocha/good-listener/blob/master/demo/nodelist.html). ```js var anchors = document.querySelectorAll('a'); listen(anchors, 'click', function(e) { console.log(e); }); ``` ### Remove an event listener By calling the `destroy` function that returned from previous operation [(see full demo)](https://github.com/zenorocha/good-listener/blob/master/demo/destroy.html). ```js var listener = listen('.btn', 'click', function(e) { console.log(e); }); listener.destroy(); ``` ## Browser Support | Chrome logo | Edge logo | Firefox logo | Internet Explorer logo | Opera logo | Safari logo | |:---:|:---:|:---:|:---:|:---:|:---:| | Latest ✔ | Latest ✔ | Latest ✔ | 9+ ✔ | Latest ✔ | Latest ✔ | ## License [MIT License](http://zenorocha.mit-license.org/) © Zeno Rocha ====================================================================== gopd@1.2.0 MIT https://github.com/ljharb/gopd MIT License Copyright (c) 2022 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== graceful-fs@4.2.11 ISC https://github.com/isaacs/node-graceful-fs The ISC License Copyright (c) 2011-2022 Isaac Z. Schlueter, Ben Noordhuis, and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== gud@1.0.0 MIT https://github.com/jamiebuilds/global-unique-id # gud > Create a 'gud nuff' (not cryptographically secure) globally unique id ## Install ``` yarn add gud ``` ## Usage ```js const gud = require('gud'); console.log(gud()); // 1 console.log(gud()); // 2 ``` This is ever so slightly better than using something like `_.uniqueId` because it will work across multiple copies of the same module. Do not use this in place of actual UUIDs, security folks will hate me. This will not be unique across processes/workers. ====================================================================== has-flag@4.0.0 MIT https://github.com/sindresorhus/has-flag MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== has-property-descriptors@1.0.2 MIT https://github.com/inspect-js/has-property-descriptors MIT License Copyright (c) 2022 Inspect JS Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== has-symbols@1.1.0 MIT https://github.com/inspect-js/has-symbols MIT License Copyright (c) 2016 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== has-tostringtag@1.0.2 MIT https://github.com/inspect-js/has-tostringtag MIT License Copyright (c) 2021 Inspect JS Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== hasown@2.0.4 MIT https://github.com/inspect-js/hasOwn MIT License Copyright (c) Jordan Harband and contributors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== hast-util-to-jsx-runtime@2.3.6 MIT https://github.com/syntax-tree/hast-util-to-jsx-runtime (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== hast-util-whitespace@3.0.0 MIT https://github.com/syntax-tree/hast-util-whitespace (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== history@4.10.1 MIT https://github.com/ReactTraining/history MIT License Copyright (c) React Training 2016-2018 Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== hoist-non-react-statics@2.5.5 BSD-3-Clause https://github.com/mridgway/hoist-non-react-statics Software License Agreement (BSD License) ======================================== Copyright (c) 2015, Yahoo! Inc. All rights reserved. ---------------------------------------------------- Redistribution and use of this software in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of Yahoo! Inc. nor the names of YUI's contributors may be used to endorse or promote products derived from this software without specific prior written permission of Yahoo! Inc. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ====================================================================== hoist-non-react-statics@3.3.2 BSD-3-Clause https://github.com/mridgway/hoist-non-react-statics Software License Agreement (BSD License) ======================================== Copyright (c) 2015, Yahoo! Inc. All rights reserved. ---------------------------------------------------- Redistribution and use of this software in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of Yahoo! Inc. nor the names of YUI's contributors may be used to endorse or promote products derived from this software without specific prior written permission of Yahoo! Inc. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ====================================================================== hosted-git-info@6.1.3 ISC https://github.com/npm/hosted-git-info Copyright (c) 2015, Rebecca Turner Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== html-url-attributes@3.0.1 MIT https://github.com/rehypejs/rehype-minify.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== html2canvas@1.4.1 MIT https://github.com/niklasvh/html2canvas Copyright (c) 2012 Niklas von Hertzen Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ieee754@1.2.1 BSD-3-Clause https://github.com/feross/ieee754 Copyright 2008 Fair Oaks Labs, Inc. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. 2. Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. 3. Neither the name of the copyright holder nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ====================================================================== immediate@3.0.6 MIT https://github.com/calvinmetcalf/immediate Copyright (c) 2012 Barnesandnoble.com, llc, Donavon West, Domenic Denicola, Brian Cavalier Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== immer@9.0.21 MIT https://github.com/immerjs/immer MIT License Copyright (c) 2017 Michel Weststrate Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== inflight@1.0.6 ISC https://github.com/npm/inflight The ISC License Copyright (c) Isaac Z. Schlueter Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== inherits@2.0.4 ISC https://github.com/isaacs/inherits The ISC License Copyright (c) Isaac Z. Schlueter Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== inline-style-parser@0.2.7 MIT https://github.com/remarkablemark/inline-style-parser (The MIT License) Copyright (c) 2012 TJ Holowaychuk Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== invariant@2.2.4 MIT https://github.com/zertosh/invariant MIT License Copyright (c) 2013-present, Facebook, Inc. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-alphabetical@2.0.1 MIT https://github.com/wooorm/is-alphabetical (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-alphanumerical@2.0.1 MIT https://github.com/wooorm/is-alphanumerical (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-arguments@1.2.0 MIT https://github.com/inspect-js/is-arguments The MIT License (MIT) Copyright (c) 2014 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-arrayish@0.3.4 MIT https://github.com/qix-/node-is-arrayish The MIT License (MIT) Copyright (c) 2015 JD Ballard Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-core-module@2.17.0 MIT https://github.com/inspect-js/is-core-module The MIT License (MIT) Copyright (c) 2014 Dave Justice Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-date-object@1.1.0 MIT https://github.com/inspect-js/is-date-object The MIT License (MIT) Copyright (c) 2015 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-decimal@2.0.1 MIT https://github.com/wooorm/is-decimal (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-fullwidth-code-point@3.0.0 MIT https://github.com/sindresorhus/is-fullwidth-code-point MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-hexadecimal@2.0.1 MIT https://github.com/wooorm/is-hexadecimal (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-mobile@3.1.1 MIT https://github.com/juliangruber/is-mobile # is-mobile Check if mobile browser, based on useragent string. [![Build Status](https://travis-ci.org/juliangruber/is-mobile.svg?branch=master)](https://travis-ci.org/juliangruber/is-mobile) ## Example ```js var mobile = require('is-mobile'); console.log(mobile()); // => false ``` ## API ### mobile({ [ua], [tablet], [featureDetect] }) Returns true if a mobile browser is being used. If you don't specify `opts.ua` it will use `navigator.userAgent`. To add support for tablets, set `tablet: true`. To enable feature detection (i.e. namely for iPad with iOS 13), set `featureDetect: true` and `tablet: true`. This will only work in browser environments. `opts.ua` can also be an instance of a [node.js http request](http://nodejs.org/api/http.html#http_http_incomingmessage), in which case it will read the user agent header. Example: ```js var http = require('http'); var mobile = require('is-mobile'); var server = http.createServer(function (req, res) { res.end(mobile({ ua: req })); }); server.listen(8000); ``` ## Installation With [npm](https://npmjs.org) do: ```bash npm install is-mobile ``` Bundle for the browser with [browserify](https://github.com/substack/node-browserify). ## Kudos Taken from [detectmobilebrowsers.com](http://detectmobilebrowsers.com/). Armv7l support added by [@antongolub](https://github.com/antongolub). ## License (MIT) Copyright (c) 2013 Julian Gruber <julian@juliangruber.com> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-plain-obj@4.1.0 MIT https://github.com/sindresorhus/is-plain-obj MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-promise@2.2.2 MIT https://github.com/then/is-promise Copyright (c) 2014 Forbes Lindesay Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== is-regex@1.2.1 MIT https://github.com/inspect-js/is-regex The MIT License (MIT) Copyright (c) 2014 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== isarray@0.0.1 MIT https://github.com/juliangruber/isarray # isarray `Array#isArray` for older browsers. ## Usage ```js var isArray = require('isarray'); console.log(isArray([])); // => true console.log(isArray({})); // => false ``` ## Installation With [npm](http://npmjs.org) do ```bash $ npm install isarray ``` Then bundle for the browser with [browserify](https://github.com/substack/browserify). With [component](http://component.io) do ```bash $ component install juliangruber/isarray ``` ## License (MIT) Copyright (c) 2013 Julian Gruber <julian@juliangruber.com> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== isarray@1.0.0 MIT https://github.com/juliangruber/isarray # isarray `Array#isArray` for older browsers. [![build status](https://secure.travis-ci.org/juliangruber/isarray.svg)](http://travis-ci.org/juliangruber/isarray) [![downloads](https://img.shields.io/npm/dm/isarray.svg)](https://www.npmjs.org/package/isarray) [![browser support](https://ci.testling.com/juliangruber/isarray.png) ](https://ci.testling.com/juliangruber/isarray) ## Usage ```js var isArray = require('isarray'); console.log(isArray([])); // => true console.log(isArray({})); // => false ``` ## Installation With [npm](http://npmjs.org) do ```bash $ npm install isarray ``` Then bundle for the browser with [browserify](https://github.com/substack/browserify). With [component](http://component.io) do ```bash $ component install juliangruber/isarray ``` ## License (MIT) Copyright (c) 2013 Julian Gruber <julian@juliangruber.com> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== isexe@2.0.0 ISC https://github.com/isaacs/isexe The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== jackspeak@3.4.3 BlueOak-1.0.0 https://github.com/isaacs/jackspeak # Blue Oak Model License Version 1.0.0 ## Purpose This license gives everyone as much permission to work with this software as possible, while protecting contributors from liability. ## Acceptance In order to receive this license, you must agree to its rules. The rules of this license are both obligations under that agreement and conditions to your license. You must not do anything with this software that triggers a rule that you cannot or will not follow. ## Copyright Each contributor licenses you to do everything with this software that would otherwise infringe that contributor's copyright in it. ## Notices You must ensure that everyone who gets a copy of any part of this software from you, with or without changes, also gets the text of this license or a link to . ## Excuse If anyone notifies you in writing that you have not complied with [Notices](#notices), you can keep your license by taking all practical steps to comply within 30 days after the notice. If you do not do so, your license ends immediately. ## Patent Each contributor licenses you to do everything with this software that would otherwise infringe any patent claims they can license or become able to license. ## Reliability No contributor can revoke this license. ## No Liability **_As far as the law allows, this software comes as is, without any warranty or condition, and no contributor will be liable to anyone for any damages related to this software or this license, under any kind of legal claim._** ====================================================================== js-tokens@4.0.0 MIT https://github.com/lydell/js-tokens The MIT License (MIT) Copyright (c) 2014, 2015, 2016, 2017, 2018 Simon Lydell Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== json-parse-even-better-errors@3.0.2 MIT https://github.com/npm/json-parse-even-better-errors Copyright 2017 Kat Marchán Copyright npm, Inc. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. --- This library is a fork of 'better-json-errors' by Kat Marchán, extended and distributed under the terms of the MIT license above. ====================================================================== jsondiffpatch@0.7.3 MIT https://github.com/benjamine/jsondiffpatch

jsondiffpatch logo

jsondiffpatch

jsondiffpatch.com
Diff & patch JavaScript objects

JsonDiffPatch CI status Created by Benjamin Eidelman License npm stars

--- ## **[Live Demo](https://jsondiffpatch.com)** - min+gzipped ~ 16KB - browser and server (ESM-only) - deep diff, use delta to patch - smart array diffing using [LCS](http://en.wikipedia.org/wiki/Longest_common_subsequence_problem), **_IMPORTANT NOTE:_** to match objects inside an array you must provide an `objectHash` function (this is how objects are matched, otherwise a dumb match by position is used). For more details, check [Array diff documentation](docs/arrays.md) - (optionally) text diffing of long strings powered by [google-diff-match-patch](http://code.google.com/p/google-diff-match-patch/) (diff at character level) - reverse a delta, unpatch (eg. revert object to its original state using a delta) - multiple output formats: - pure JSON, low footprint [delta format](docs/deltas.md) - visual diff (html), see [demo](https://jsondiffpatch.com) - annotated JSON (html), to help explain the delta format with annotations - JSON Patch ([RFC 6902](https://datatracker.ietf.org/doc/html/rfc6902)), can generate patches, and also apply them - console (colored), try running `./node_modules/.bin/jsondiffpatch left.json right.json` - write your own! check [Formatters documentation](docs/formatters.md) - BONUS: `jsondiffpatch.clone(obj)` (deep clone) ## Supported platforms - Any browser that [supports ES6](https://caniuse.com/es6) - Node.js 18, 20+ ## Usage on your terminal: ```sh npx jsondiffpatch --help ``` ![console_demo!](docs/demo/consoledemo.png) or as a library: ```ts // sample data const country = { name: 'Argentina', capital: 'Buenos Aires', independence: new Date(1816, 6, 9), }; // clone country, using dateReviver for Date objects const country2 = JSON.parse(JSON.stringify(country), jsondiffpatch.dateReviver); // make some changes country2.name = 'Republica Argentina'; country2.population = 41324992; delete country2.capital; const delta = jsondiffpatch.diff(country, country2); assertSame(delta, { name: ['Argentina', 'Republica Argentina'], // old value, new value population: ['41324992'], // new value capital: ['Buenos Aires', 0, 0], // deleted }); // patch original jsondiffpatch.patch(country, delta); // reverse diff const reverseDelta = jsondiffpatch.reverse(delta); // also country2 can be return to original value with: jsondiffpatch.unpatch(country2, delta); const delta2 = jsondiffpatch.diff(country, country2); assert(delta2 === undefined); // undefined => no difference ``` Array diffing: ```ts // sample data const country = { name: 'Argentina', cities: [ { name: 'Buenos Aires', population: 13028000, }, { name: 'Cordoba', population: 1430023, }, { name: 'Rosario', population: 1136286, }, { name: 'Mendoza', population: 901126, }, { name: 'San Miguel de Tucuman', population: 800000, }, ], }; // clone country const country2 = JSON.parse(JSON.stringify(country)); // delete Cordoba country.cities.splice(1, 1); // add La Plata country.cities.splice(4, 0, { name: 'La Plata', }); // modify Rosario, and move it const rosario = country.cities.splice(1, 1)[0]; rosario.population += 1234; country.cities.push(rosario); // create a configured instance, match objects by name const diffpatcher = jsondiffpatch.create({ objectHash: function (obj) { return obj.name; }, }); const delta = diffpatcher.diff(country, country2); assertSame(delta, { cities: { _t: 'a', // indicates this node is an array (not an object) 1: [ // inserted at index 1 { name: 'Cordoba', population: 1430023, }, ], 2: { // population modified at index 2 (Rosario) population: [1137520, 1136286], }, _3: [ // removed from index 3 { name: 'La Plata', }, 0, 0, ], _4: [ // move from index 4 to index 2 '', 2, 3, ], }, }); ``` For more example cases (nested objects or arrays, long text diffs) check `packages/jsondiffpatch/test/examples/` If you want to understand deltas, see [delta format documentation](docs/deltas.md) ## Installing ### NPM This works for node, or in browsers if you already do bundling on your app ```sh npm install jsondiffpatch ``` ```js import {* as jsondiffpatch} from 'jsondiffpatch'; const jsondiffpatchInstance = jsondiffpatch.create(options); ``` ### browser In a browser, you can load a bundle using a tool like [esm.sh](https://esm.sh) or [Skypack](https://www.skypack.dev). ## Options ```ts import * as jsondiffpatch from 'jsondiffpatch'; // Only import if you want text diffs using diff-match-patch import { diff_match_patch } from '@dmsnell/diff-match-patch'; const jsondiffpatchInstance = jsondiffpatch.create({ // used to match objects when diffing arrays, by default only === operator is used objectHash: function (obj) { // this function is used only to when objects are not equal by ref return obj._id || obj.id; }, arrays: { // default true, detect items moved inside the array (otherwise they will be registered as remove+add) detectMove: true, // default false, the value of items moved is not included in deltas includeValueOnMove: false, }, textDiff: { // If using text diffs, it's required to pass in the diff-match-patch library in through this proprty. // Alternatively, you can import jsondiffpatch using `jsondiffpatch/with-text-diffs` to avoid having to pass in diff-match-patch through the options. diffMatchPatch: diff_match_patch, // default 60, minimum string length (left and right sides) to use text diff algorithm: google-diff-match-patch minLength: 60, }, propertyFilter: function (name, context) { /* this optional function can be specified to ignore object properties (eg. volatile data) name: property name, present in either context.left or context.right objects context: the diff context (has context.left and context.right objects) */ return name.slice(0, 1) !== '$'; }, cloneDiffValues: false /* default false. if true, values in the obtained delta will be cloned (using jsondiffpatch.clone by default), to ensure delta keeps no references to left or right objects. this becomes useful if you're diffing and patching the same objects multiple times without serializing deltas. instead of true, a function can be specified here to provide a custom clone(value). */ omitRemovedValues: false /* if you don't need to unpatch (reverse deltas), "old"/"left" values (removed or replaced) are not included in the delta. you can set this to true to get more compact deltas. */, }); ``` ## Visual Diff ```html
``` To see formatters in action check the [Live Demo](https://jsondiffpatch.com). For more details check [Formatters documentation](docs/formatters.md) ## Plugins `diff()`, `patch()` and `reverse()` functions are implemented using Pipes & Filters pattern, making it extremely customizable by adding or replacing filters on a pipe. Check [Plugins documentation](docs/plugins.md) for details. ## Related Projects - [jsondiffpatch.net (C#) ](https://github.com/wbish/jsondiffpatch.net) - [SystemTextJson.JsonDiffPatch (C#)](https://github.com/weichch/system-text-json-jsondiffpatch) - [Go JSON Diff (and Patch) ](https://github.com/yudai/gojsondiff) - [json-diff-patch (python)](https://github.com/apack1001/json-diff-patch) - [jsondiffpatch-react](https://github.com/bluepeter/jsondiffpatch-react), also check docs for [usage in react](/docs/react.md) ## All contributors ✨

A table of avatars from the project's contributors

====================================================================== jszip@3.10.2 (MIT OR GPL-3.0-or-later) https://github.com/Stuk/jszip JSZip is dual licensed. At your choice you may use it under the MIT license *or* the GPLv3 license. The MIT License =============== Copyright (c) 2009-2016 Stuart Knightley, David Duponchel, Franz Buchinger, António Afonso Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. GPL version 3 ============= GNU GENERAL PUBLIC LICENSE Version 3, 29 June 2007 Copyright (C) 2007 Free Software Foundation, Inc. Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed. Preamble The GNU General Public License is a free, copyleft license for software and other kinds of works. The licenses for most software and other practical works are designed to take away your freedom to share and change the works. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change all versions of a program--to make sure it remains free software for all its users. We, the Free Software Foundation, use the GNU General Public License for most of our software; it applies also to any other work released this way by its authors. You can apply it to your programs, too. When we speak of free software, we are referring to freedom, not price. Our General Public Licenses are designed to make sure that you have the freedom to distribute copies of free software (and charge for them if you wish), that you receive source code or can get it if you want it, that you can change the software or use pieces of it in new free programs, and that you know you can do these things. To protect your rights, we need to prevent others from denying you these rights or asking you to surrender the rights. Therefore, you have certain responsibilities if you distribute copies of the software, or if you modify it: responsibilities to respect the freedom of others. For example, if you distribute copies of such a program, whether gratis or for a fee, you must pass on to the recipients the same freedoms that you received. You must make sure that they, too, receive or can get the source code. And you must show them these terms so they know their rights. Developers that use the GNU GPL protect your rights with two steps: (1) assert copyright on the software, and (2) offer you this License giving you legal permission to copy, distribute and/or modify it. For the developers' and authors' protection, the GPL clearly explains that there is no warranty for this free software. For both users' and authors' sake, the GPL requires that modified versions be marked as changed, so that their problems will not be attributed erroneously to authors of previous versions. Some devices are designed to deny users access to install or run modified versions of the software inside them, although the manufacturer can do so. This is fundamentally incompatible with the aim of protecting users' freedom to change the software. The systematic pattern of such abuse occurs in the area of products for individuals to use, which is precisely where it is most unacceptable. Therefore, we have designed this version of the GPL to prohibit the practice for those products. If such problems arise substantially in other domains, we stand ready to extend this provision to those domains in future versions of the GPL, as needed to protect the freedom of users. Finally, every program is threatened constantly by software patents. States should not allow patents to restrict development and use of software on general-purpose computers, but in those that do, we wish to avoid the special danger that patents applied to a free program could make it effectively proprietary. To prevent this, the GPL assures that patents cannot be used to render the program non-free. The precise terms and conditions for copying, distribution and modification follow. TERMS AND CONDITIONS 0. Definitions. "This License" refers to version 3 of the GNU General Public License. "Copyright" also means copyright-like laws that apply to other kinds of works, such as semiconductor masks. "The Program" refers to any copyrightable work licensed under this License. Each licensee is addressed as "you". "Licensees" and "recipients" may be individuals or organizations. To "modify" a work means to copy from or adapt all or part of the work in a fashion requiring copyright permission, other than the making of an exact copy. The resulting work is called a "modified version" of the earlier work or a work "based on" the earlier work. A "covered work" means either the unmodified Program or a work based on the Program. To "propagate" a work means to do anything with it that, without permission, would make you directly or secondarily liable for infringement under applicable copyright law, except executing it on a computer or modifying a private copy. Propagation includes copying, distribution (with or without modification), making available to the public, and in some countries other activities as well. To "convey" a work means any kind of propagation that enables other parties to make or receive copies. Mere interaction with a user through a computer network, with no transfer of a copy, is not conveying. An interactive user interface displays "Appropriate Legal Notices" to the extent that it includes a convenient and prominently visible feature that (1) displays an appropriate copyright notice, and (2) tells the user that there is no warranty for the work (except to the extent that warranties are provided), that licensees may convey the work under this License, and how to view a copy of this License. If the interface presents a list of user commands or options, such as a menu, a prominent item in the list meets this criterion. 1. Source Code. The "source code" for a work means the preferred form of the work for making modifications to it. "Object code" means any non-source form of a work. A "Standard Interface" means an interface that either is an official standard defined by a recognized standards body, or, in the case of interfaces specified for a particular programming language, one that is widely used among developers working in that language. The "System Libraries" of an executable work include anything, other than the work as a whole, that (a) is included in the normal form of packaging a Major Component, but which is not part of that Major Component, and (b) serves only to enable use of the work with that Major Component, or to implement a Standard Interface for which an implementation is available to the public in source code form. A "Major Component", in this context, means a major essential component (kernel, window system, and so on) of the specific operating system (if any) on which the executable work runs, or a compiler used to produce the work, or an object code interpreter used to run it. The "Corresponding Source" for a work in object code form means all the source code needed to generate, install, and (for an executable work) run the object code and to modify the work, including scripts to control those activities. However, it does not include the work's System Libraries, or general-purpose tools or generally available free programs which are used unmodified in performing those activities but which are not part of the work. For example, Corresponding Source includes interface definition files associated with source files for the work, and the source code for shared libraries and dynamically linked subprograms that the work is specifically designed to require, such as by intimate data communication or control flow between those subprograms and other parts of the work. The Corresponding Source need not include anything that users can regenerate automatically from other parts of the Corresponding Source. The Corresponding Source for a work in source code form is that same work. 2. Basic Permissions. All rights granted under this License are granted for the term of copyright on the Program, and are irrevocable provided the stated conditions are met. This License explicitly affirms your unlimited permission to run the unmodified Program. The output from running a covered work is covered by this License only if the output, given its content, constitutes a covered work. This License acknowledges your rights of fair use or other equivalent, as provided by copyright law. You may make, run and propagate covered works that you do not convey, without conditions so long as your license otherwise remains in force. You may convey covered works to others for the sole purpose of having them make modifications exclusively for you, or provide you with facilities for running those works, provided that you comply with the terms of this License in conveying all material for which you do not control copyright. Those thus making or running the covered works for you must do so exclusively on your behalf, under your direction and control, on terms that prohibit them from making any copies of your copyrighted material outside their relationship with you. Conveying under any other circumstances is permitted solely under the conditions stated below. Sublicensing is not allowed; section 10 makes it unnecessary. 3. Protecting Users' Legal Rights From Anti-Circumvention Law. No covered work shall be deemed part of an effective technological measure under any applicable law fulfilling obligations under article 11 of the WIPO copyright treaty adopted on 20 December 1996, or similar laws prohibiting or restricting circumvention of such measures. When you convey a covered work, you waive any legal power to forbid circumvention of technological measures to the extent such circumvention is effected by exercising rights under this License with respect to the covered work, and you disclaim any intention to limit operation or modification of the work as a means of enforcing, against the work's users, your or third parties' legal rights to forbid circumvention of technological measures. 4. Conveying Verbatim Copies. You may convey verbatim copies of the Program's source code as you receive it, in any medium, provided that you conspicuously and appropriately publish on each copy an appropriate copyright notice; keep intact all notices stating that this License and any non-permissive terms added in accord with section 7 apply to the code; keep intact all notices of the absence of any warranty; and give all recipients a copy of this License along with the Program. You may charge any price or no price for each copy that you convey, and you may offer support or warranty protection for a fee. 5. Conveying Modified Source Versions. You may convey a work based on the Program, or the modifications to produce it from the Program, in the form of source code under the terms of section 4, provided that you also meet all of these conditions: a) The work must carry prominent notices stating that you modified it, and giving a relevant date. b) The work must carry prominent notices stating that it is released under this License and any conditions added under section 7. This requirement modifies the requirement in section 4 to "keep intact all notices". c) You must license the entire work, as a whole, under this License to anyone who comes into possession of a copy. This License will therefore apply, along with any applicable section 7 additional terms, to the whole of the work, and all its parts, regardless of how they are packaged. This License gives no permission to license the work in any other way, but it does not invalidate such permission if you have separately received it. d) If the work has interactive user interfaces, each must display Appropriate Legal Notices; however, if the Program has interactive interfaces that do not display Appropriate Legal Notices, your work need not make them do so. A compilation of a covered work with other separate and independent works, which are not by their nature extensions of the covered work, and which are not combined with it such as to form a larger program, in or on a volume of a storage or distribution medium, is called an "aggregate" if the compilation and its resulting copyright are not used to limit the access or legal rights of the compilation's users beyond what the individual works permit. Inclusion of a covered work in an aggregate does not cause this License to apply to the other parts of the aggregate. 6. Conveying Non-Source Forms. You may convey a covered work in object code form under the terms of sections 4 and 5, provided that you also convey the machine-readable Corresponding Source under the terms of this License, in one of these ways: a) Convey the object code in, or embodied in, a physical product (including a physical distribution medium), accompanied by the Corresponding Source fixed on a durable physical medium customarily used for software interchange. b) Convey the object code in, or embodied in, a physical product (including a physical distribution medium), accompanied by a written offer, valid for at least three years and valid for as long as you offer spare parts or customer support for that product model, to give anyone who possesses the object code either (1) a copy of the Corresponding Source for all the software in the product that is covered by this License, on a durable physical medium customarily used for software interchange, for a price no more than your reasonable cost of physically performing this conveying of source, or (2) access to copy the Corresponding Source from a network server at no charge. c) Convey individual copies of the object code with a copy of the written offer to provide the Corresponding Source. This alternative is allowed only occasionally and noncommercially, and only if you received the object code with such an offer, in accord with subsection 6b. d) Convey the object code by offering access from a designated place (gratis or for a charge), and offer equivalent access to the Corresponding Source in the same way through the same place at no further charge. You need not require recipients to copy the Corresponding Source along with the object code. If the place to copy the object code is a network server, the Corresponding Source may be on a different server (operated by you or a third party) that supports equivalent copying facilities, provided you maintain clear directions next to the object code saying where to find the Corresponding Source. Regardless of what server hosts the Corresponding Source, you remain obligated to ensure that it is available for as long as needed to satisfy these requirements. e) Convey the object code using peer-to-peer transmission, provided you inform other peers where the object code and Corresponding Source of the work are being offered to the general public at no charge under subsection 6d. A separable portion of the object code, whose source code is excluded from the Corresponding Source as a System Library, need not be included in conveying the object code work. A "User Product" is either (1) a "consumer product", which means any tangible personal property which is normally used for personal, family, or household purposes, or (2) anything designed or sold for incorporation into a dwelling. In determining whether a product is a consumer product, doubtful cases shall be resolved in favor of coverage. For a particular product received by a particular user, "normally used" refers to a typical or common use of that class of product, regardless of the status of the particular user or of the way in which the particular user actually uses, or expects or is expected to use, the product. A product is a consumer product regardless of whether the product has substantial commercial, industrial or non-consumer uses, unless such uses represent the only significant mode of use of the product. "Installation Information" for a User Product means any methods, procedures, authorization keys, or other information required to install and execute modified versions of a covered work in that User Product from a modified version of its Corresponding Source. The information must suffice to ensure that the continued functioning of the modified object code is in no case prevented or interfered with solely because modification has been made. If you convey an object code work under this section in, or with, or specifically for use in, a User Product, and the conveying occurs as part of a transaction in which the right of possession and use of the User Product is transferred to the recipient in perpetuity or for a fixed term (regardless of how the transaction is characterized), the Corresponding Source conveyed under this section must be accompanied by the Installation Information. But this requirement does not apply if neither you nor any third party retains the ability to install modified object code on the User Product (for example, the work has been installed in ROM). The requirement to provide Installation Information does not include a requirement to continue to provide support service, warranty, or updates for a work that has been modified or installed by the recipient, or for the User Product in which it has been modified or installed. Access to a network may be denied when the modification itself materially and adversely affects the operation of the network or violates the rules and protocols for communication across the network. Corresponding Source conveyed, and Installation Information provided, in accord with this section must be in a format that is publicly documented (and with an implementation available to the public in source code form), and must require no special password or key for unpacking, reading or copying. 7. Additional Terms. "Additional permissions" are terms that supplement the terms of this License by making exceptions from one or more of its conditions. Additional permissions that are applicable to the entire Program shall be treated as though they were included in this License, to the extent that they are valid under applicable law. If additional permissions apply only to part of the Program, that part may be used separately under those permissions, but the entire Program remains governed by this License without regard to the additional permissions. When you convey a copy of a covered work, you may at your option remove any additional permissions from that copy, or from any part of it. (Additional permissions may be written to require their own removal in certain cases when you modify the work.) You may place additional permissions on material, added by you to a covered work, for which you have or can give appropriate copyright permission. Notwithstanding any other provision of this License, for material you add to a covered work, you may (if authorized by the copyright holders of that material) supplement the terms of this License with terms: a) Disclaiming warranty or limiting liability differently from the terms of sections 15 and 16 of this License; or b) Requiring preservation of specified reasonable legal notices or author attributions in that material or in the Appropriate Legal Notices displayed by works containing it; or c) Prohibiting misrepresentation of the origin of that material, or requiring that modified versions of such material be marked in reasonable ways as different from the original version; or d) Limiting the use for publicity purposes of names of licensors or authors of the material; or e) Declining to grant rights under trademark law for use of some trade names, trademarks, or service marks; or f) Requiring indemnification of licensors and authors of that material by anyone who conveys the material (or modified versions of it) with contractual assumptions of liability to the recipient, for any liability that these contractual assumptions directly impose on those licensors and authors. All other non-permissive additional terms are considered "further restrictions" within the meaning of section 10. If the Program as you received it, or any part of it, contains a notice stating that it is governed by this License along with a term that is a further restriction, you may remove that term. If a license document contains a further restriction but permits relicensing or conveying under this License, you may add to a covered work material governed by the terms of that license document, provided that the further restriction does not survive such relicensing or conveying. If you add terms to a covered work in accord with this section, you must place, in the relevant source files, a statement of the additional terms that apply to those files, or a notice indicating where to find the applicable terms. Additional terms, permissive or non-permissive, may be stated in the form of a separately written license, or stated as exceptions; the above requirements apply either way. 8. Termination. You may not propagate or modify a covered work except as expressly provided under this License. Any attempt otherwise to propagate or modify it is void, and will automatically terminate your rights under this License (including any patent licenses granted under the third paragraph of section 11). However, if you cease all violation of this License, then your license from a particular copyright holder is reinstated (a) provisionally, unless and until the copyright holder explicitly and finally terminates your license, and (b) permanently, if the copyright holder fails to notify you of the violation by some reasonable means prior to 60 days after the cessation. Moreover, your license from a particular copyright holder is reinstated permanently if the copyright holder notifies you of the violation by some reasonable means, this is the first time you have received notice of violation of this License (for any work) from that copyright holder, and you cure the violation prior to 30 days after your receipt of the notice. Termination of your rights under this section does not terminate the licenses of parties who have received copies or rights from you under this License. If your rights have been terminated and not permanently reinstated, you do not qualify to receive new licenses for the same material under section 10. 9. Acceptance Not Required for Having Copies. You are not required to accept this License in order to receive or run a copy of the Program. Ancillary propagation of a covered work occurring solely as a consequence of using peer-to-peer transmission to receive a copy likewise does not require acceptance. However, nothing other than this License grants you permission to propagate or modify any covered work. These actions infringe copyright if you do not accept this License. Therefore, by modifying or propagating a covered work, you indicate your acceptance of this License to do so. 10. Automatic Licensing of Downstream Recipients. Each time you convey a covered work, the recipient automatically receives a license from the original licensors, to run, modify and propagate that work, subject to this License. You are not responsible for enforcing compliance by third parties with this License. An "entity transaction" is a transaction transferring control of an organization, or substantially all assets of one, or subdividing an organization, or merging organizations. If propagation of a covered work results from an entity transaction, each party to that transaction who receives a copy of the work also receives whatever licenses to the work the party's predecessor in interest had or could give under the previous paragraph, plus a right to possession of the Corresponding Source of the work from the predecessor in interest, if the predecessor has it or can get it with reasonable efforts. You may not impose any further restrictions on the exercise of the rights granted or affirmed under this License. For example, you may not impose a license fee, royalty, or other charge for exercise of rights granted under this License, and you may not initiate litigation (including a cross-claim or counterclaim in a lawsuit) alleging that any patent claim is infringed by making, using, selling, offering for sale, or importing the Program or any portion of it. 11. Patents. A "contributor" is a copyright holder who authorizes use under this License of the Program or a work on which the Program is based. The work thus licensed is called the contributor's "contributor version". A contributor's "essential patent claims" are all patent claims owned or controlled by the contributor, whether already acquired or hereafter acquired, that would be infringed by some manner, permitted by this License, of making, using, or selling its contributor version, but do not include claims that would be infringed only as a consequence of further modification of the contributor version. For purposes of this definition, "control" includes the right to grant patent sublicenses in a manner consistent with the requirements of this License. Each contributor grants you a non-exclusive, worldwide, royalty-free patent license under the contributor's essential patent claims, to make, use, sell, offer for sale, import and otherwise run, modify and propagate the contents of its contributor version. In the following three paragraphs, a "patent license" is any express agreement or commitment, however denominated, not to enforce a patent (such as an express permission to practice a patent or covenant not to sue for patent infringement). To "grant" such a patent license to a party means to make such an agreement or commitment not to enforce a patent against the party. If you convey a covered work, knowingly relying on a patent license, and the Corresponding Source of the work is not available for anyone to copy, free of charge and under the terms of this License, through a publicly available network server or other readily accessible means, then you must either (1) cause the Corresponding Source to be so available, or (2) arrange to deprive yourself of the benefit of the patent license for this particular work, or (3) arrange, in a manner consistent with the requirements of this License, to extend the patent license to downstream recipients. "Knowingly relying" means you have actual knowledge that, but for the patent license, your conveying the covered work in a country, or your recipient's use of the covered work in a country, would infringe one or more identifiable patents in that country that you have reason to believe are valid. If, pursuant to or in connection with a single transaction or arrangement, you convey, or propagate by procuring conveyance of, a covered work, and grant a patent license to some of the parties receiving the covered work authorizing them to use, propagate, modify or convey a specific copy of the covered work, then the patent license you grant is automatically extended to all recipients of the covered work and works based on it. A patent license is "discriminatory" if it does not include within the scope of its coverage, prohibits the exercise of, or is conditioned on the non-exercise of one or more of the rights that are specifically granted under this License. You may not convey a covered work if you are a party to an arrangement with a third party that is in the business of distributing software, under which you make payment to the third party based on the extent of your activity of conveying the work, and under which the third party grants, to any of the parties who would receive the covered work from you, a discriminatory patent license (a) in connection with copies of the covered work conveyed by you (or copies made from those copies), or (b) primarily for and in connection with specific products or compilations that contain the covered work, unless you entered into that arrangement, or that patent license was granted, prior to 28 March 2007. Nothing in this License shall be construed as excluding or limiting any implied license or other defenses to infringement that may otherwise be available to you under applicable patent law. 12. No Surrender of Others' Freedom. If conditions are imposed on you (whether by court order, agreement or otherwise) that contradict the conditions of this License, they do not excuse you from the conditions of this License. If you cannot convey a covered work so as to satisfy simultaneously your obligations under this License and any other pertinent obligations, then as a consequence you may not convey it at all. For example, if you agree to terms that obligate you to collect a royalty for further conveying from those to whom you convey the Program, the only way you could satisfy both those terms and this License would be to refrain entirely from conveying the Program. 13. Use with the GNU Affero General Public License. Notwithstanding any other provision of this License, you have permission to link or combine any covered work with a work licensed under version 3 of the GNU Affero General Public License into a single combined work, and to convey the resulting work. The terms of this License will continue to apply to the part which is the covered work, but the special requirements of the GNU Affero General Public License, section 13, concerning interaction through a network will apply to the combination as such. 14. Revised Versions of this License. The Free Software Foundation may publish revised and/or new versions of the GNU General Public License from time to time. Such new versions will be similar in spirit to the present version, but may differ in detail to address new problems or concerns. Each version is given a distinguishing version number. If the Program specifies that a certain numbered version of the GNU General Public License "or any later version" applies to it, you have the option of following the terms and conditions either of that numbered version or of any later version published by the Free Software Foundation. If the Program does not specify a version number of the GNU General Public License, you may choose any version ever published by the Free Software Foundation. If the Program specifies that a proxy can decide which future versions of the GNU General Public License can be used, that proxy's public statement of acceptance of a version permanently authorizes you to choose that version for the Program. Later license versions may give you additional or different permissions. However, no additional obligations are imposed on any author or copyright holder as a result of your choosing to follow a later version. 15. Disclaimer of Warranty. THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION. 16. Limitation of Liability. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. 17. Interpretation of Sections 15 and 16. If the disclaimer of warranty and limitation of liability provided above cannot be given local legal effect according to their terms, reviewing courts shall apply local law that most closely approximates an absolute waiver of all civil liability in connection with the Program, unless a warranty or assumption of liability accompanies a copy of the Program in return for a fee. END OF TERMS AND CONDITIONS ====================================================================== lazystream@1.0.1 MIT https://github.com/jpommerening/node-lazystream Copyright (c) 2013 J. Pommerening, contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== license-checker-rseidelsohn@4.4.2 BSD-3-Clause https://github.com/RSeidelsohn/license-checker-rseidelsohn Copyright 2012 Yahoo Inc. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of the Yahoo! Inc. nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL YAHOO! INC. BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ====================================================================== lie@3.3.0 MIT https://github.com/calvinmetcalf/lie #Copyright (c) 2014-2018 Calvin Metcalf, Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. **THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.** ====================================================================== lodash-es@4.18.1 MIT https://github.com/lodash/lodash Copyright OpenJS Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash.clonedeep@4.5.0 MIT https://github.com/lodash/lodash Copyright jQuery Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash.defaults@4.2.0 MIT https://github.com/lodash/lodash Copyright jQuery Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash.difference@4.5.0 MIT https://github.com/lodash/lodash Copyright jQuery Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash.flatten@4.4.0 MIT https://github.com/lodash/lodash Copyright jQuery Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash.isplainobject@4.0.6 MIT https://github.com/lodash/lodash Copyright jQuery Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash.union@4.6.0 MIT https://github.com/lodash/lodash Copyright jQuery Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== lodash@4.17.21 MIT https://github.com/lodash/lodash Copyright OpenJS Foundation and other contributors Based on Underscore.js, copyright Jeremy Ashkenas, DocumentCloud and Investigative Reporters & Editors This software consists of voluntary contributions made by many individuals. For exact contribution history, see the revision history available at https://github.com/lodash/lodash The following license applies to all parts of this software except as documented below: ==== Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ==== Copyright and related rights for sample code are waived via CC0. Sample code is defined as all source code displayed within the prose of the documentation. CC0: http://creativecommons.org/publicdomain/zero/1.0/ ==== Files located in the node_modules and vendor directories are externally maintained libraries used by this software which have their own licenses; we recommend you read them, as their terms may differ from the terms above. ====================================================================== longest-streak@3.1.0 MIT https://github.com/wooorm/longest-streak (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== loose-envify@1.4.0 MIT https://github.com/zertosh/loose-envify The MIT License (MIT) Copyright (c) 2015 Andres Suarez Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== lru-cache@10.4.3 ISC https://github.com/isaacs/node-lru-cache The ISC License Copyright (c) 2010-2023 Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== lru-cache@7.18.3 ISC https://github.com/isaacs/node-lru-cache The ISC License Copyright (c) 2010-2023 Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== markdown-table@3.0.4 MIT https://github.com/wooorm/markdown-table (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== material-colors@1.2.6 ISC https://github.com/shuhei/material-colors ISC License Copyright 2014 Shuhei Kagawa Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== math-expression-evaluator@1.4.0 MIT https://github.com/redhivesoftware/math-expression-evaluator The MIT License (MIT) Copyright (c) 2015 Ankit G. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== math-intrinsics@1.1.0 MIT https://github.com/es-shims/math-intrinsics MIT License Copyright (c) 2024 ECMAScript Shims Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-find-and-replace@3.0.2 MIT https://github.com/syntax-tree/mdast-util-find-and-replace (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-from-markdown@2.0.3 MIT https://github.com/syntax-tree/mdast-util-from-markdown (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-gfm-autolink-literal@2.0.1 MIT https://github.com/syntax-tree/mdast-util-gfm-autolink-literal (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-gfm-footnote@2.1.0 MIT https://github.com/syntax-tree/mdast-util-gfm-footnote (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-gfm-strikethrough@2.0.0 MIT https://github.com/syntax-tree/mdast-util-gfm-strikethrough (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-gfm-table@2.0.0 MIT https://github.com/syntax-tree/mdast-util-gfm-table (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-gfm-task-list-item@2.0.0 MIT https://github.com/syntax-tree/mdast-util-gfm-task-list-item (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-gfm@3.1.0 MIT https://github.com/syntax-tree/mdast-util-gfm (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-mdx-expression@2.0.1 MIT https://github.com/syntax-tree/mdast-util-mdx-expression (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-mdx-jsx@3.2.0 MIT https://github.com/syntax-tree/mdast-util-mdx-jsx (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-mdxjs-esm@2.0.1 MIT https://github.com/syntax-tree/mdast-util-mdxjs-esm (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-phrasing@4.1.0 MIT https://github.com/syntax-tree/mdast-util-phrasing (The MIT License) Copyright (c) 2017 Titus Wormer Copyright (c) 2017 Victor Felder Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-to-hast@13.2.1 MIT https://github.com/syntax-tree/mdast-util-to-hast (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-to-markdown@2.1.2 MIT https://github.com/syntax-tree/mdast-util-to-markdown (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mdast-util-to-string@4.0.0 MIT https://github.com/syntax-tree/mdast-util-to-string (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== memoize-one@6.0.0 MIT https://github.com/alexreardon/memoize-one MIT License Copyright (c) 2019 Alexander Reardon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-core-commonmark@2.0.3 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm-autolink-literal@2.1.0 MIT https://github.com/micromark/micromark-extension-gfm-autolink-literal (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm-footnote@2.1.0 MIT https://github.com/micromark/micromark-extension-gfm-footnote (The MIT License) Copyright (c) 2021 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm-strikethrough@2.1.0 MIT https://github.com/micromark/micromark-extension-gfm-strikethrough (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm-table@2.1.2 MIT https://github.com/micromark/micromark-extension-gfm-table (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm-tagfilter@2.0.0 MIT https://github.com/micromark/micromark-extension-gfm-tagfilter (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm-task-list-item@2.1.0 MIT https://github.com/micromark/micromark-extension-gfm-task-list-item (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-extension-gfm@3.0.0 MIT https://github.com/micromark/micromark-extension-gfm (The MIT License) Copyright (c) 2020 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-factory-destination@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-factory-label@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-factory-space@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-factory-title@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-factory-whitespace@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-character@2.1.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-chunked@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-classify-character@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-combine-extensions@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-decode-numeric-character-reference@2.0.2 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-decode-string@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-encode@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-html-tag-name@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-normalize-identifier@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-resolve-all@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-sanitize-uri@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-subtokenize@2.1.0 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-symbol@2.0.1 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark-util-types@2.0.2 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== micromark@4.0.2 MIT https://github.com/micromark/micromark.git#main (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== minimatch@3.1.5 ISC https://github.com/isaacs/minimatch The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== minimatch@5.1.9 ISC https://github.com/isaacs/minimatch The ISC License Copyright (c) 2011-2023 Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== minimatch@9.0.9 ISC https://github.com/isaacs/minimatch The ISC License Copyright (c) 2011-2023 Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== minipass@7.1.3 BlueOak-1.0.0 https://github.com/isaacs/minipass # Blue Oak Model License Version 1.0.0 ## Purpose This license gives everyone as much permission to work with this software as possible, while protecting contributors from liability. ## Acceptance In order to receive this license, you must agree to its rules. The rules of this license are both obligations under that agreement and conditions to your license. You must not do anything with this software that triggers a rule that you cannot or will not follow. ## Copyright Each contributor licenses you to do everything with this software that would otherwise infringe that contributor's copyright in it. ## Notices You must ensure that everyone who gets a copy of any part of this software from you, with or without changes, also gets the text of this license or a link to . ## Excuse If anyone notifies you in writing that you have not complied with [Notices](#notices), you can keep your license by taking all practical steps to comply within 30 days after the notice. If you do not do so, your license ends immediately. ## Patent Each contributor licenses you to do everything with this software that would otherwise infringe any patent claims they can license or become able to license. ## Reliability No contributor can revoke this license. ## No Liability ***As far as the law allows, this software comes as is, without any warranty or condition, and no contributor will be liable to anyone for any damages related to this software or this license, under any kind of legal claim.*** ====================================================================== mkdirp@1.0.4 MIT https://github.com/isaacs/node-mkdirp Copyright James Halliday (mail@substack.net) and Isaac Z. Schlueter (i@izs.me) This project is free software released under the MIT license: Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== mobx@6.16.1 MIT https://github.com/mobxjs/mobx The MIT License (MIT) Copyright (c) 2015 Michel Weststrate Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== ms@2.1.3 MIT https://github.com/vercel/ms The MIT License (MIT) Copyright (c) 2020 Vercel, Inc. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== nanoid@2.1.11 MIT https://github.com/ai/nanoid The MIT License (MIT) Copyright 2017 Andrey Sitnik Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== nanoid@4.0.2 MIT https://github.com/ai/nanoid The MIT License (MIT) Copyright 2017 Andrey Sitnik Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== node-interval-tree@1.3.3 MIT https://github.com/ShieldBattery/node-interval-tree The MIT License (MIT) Copyright (c) 2016 Marko Žarković Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== nopt@7.2.1 ISC https://github.com/npm/nopt The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== normalize-package-data@5.0.0 BSD-2-Clause https://github.com/npm/normalize-package-data This package contains code originally written by Isaac Z. Schlueter. Used with permission. Copyright (c) Meryn Stol ("Author") All rights reserved. The BSD License Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. 2. Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ====================================================================== normalize-path@3.0.0 MIT https://github.com/jonschlinkert/normalize-path The MIT License (MIT) Copyright (c) 2014-2018, Jon Schlinkert. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== normalize.css@8.0.1 MIT https://github.com/necolas/normalize.css # The MIT License (MIT) Copyright © Nicolas Gallagher and Jonathan Neal Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== npm-normalize-package-bin@3.0.1 ISC https://github.com/npm/npm-normalize-package-bin The ISC License Copyright (c) npm, Inc. Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== object-assign@4.1.1 MIT https://github.com/sindresorhus/object-assign The MIT License (MIT) Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== object-inspect@1.13.4 MIT https://github.com/inspect-js/object-inspect MIT License Copyright (c) 2013 James Halliday Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== object-is@1.1.6 MIT https://github.com/es-shims/object-is The MIT License (MIT) Copyright (c) 2014 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== object-keys@1.1.1 MIT https://github.com/ljharb/object-keys The MIT License (MIT) Copyright (C) 2013 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== once@1.4.0 ISC https://github.com/isaacs/once The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== package-json-from-dist@1.0.1 BlueOak-1.0.0 https://github.com/isaacs/package-json-from-dist All packages under `src/` are licensed according to the terms in their respective `LICENSE` or `LICENSE.md` files. The remainder of this project is licensed under the Blue Oak Model License, as follows: ----- # Blue Oak Model License Version 1.0.0 ## Purpose This license gives everyone as much permission to work with this software as possible, while protecting contributors from liability. ## Acceptance In order to receive this license, you must agree to its rules. The rules of this license are both obligations under that agreement and conditions to your license. You must not do anything with this software that triggers a rule that you cannot or will not follow. ## Copyright Each contributor licenses you to do everything with this software that would otherwise infringe that contributor's copyright in it. ## Notices You must ensure that everyone who gets a copy of any part of this software from you, with or without changes, also gets the text of this license or a link to . ## Excuse If anyone notifies you in writing that you have not complied with [Notices](#notices), you can keep your license by taking all practical steps to comply within 30 days after the notice. If you do not do so, your license ends immediately. ## Patent Each contributor licenses you to do everything with this software that would otherwise infringe any patent claims they can license or become able to license. ## Reliability No contributor can revoke this license. ## No Liability ***As far as the law allows, this software comes as is, without any warranty or condition, and no contributor will be liable to anyone for any damages related to this software or this license, under any kind of legal claim.*** ====================================================================== pako@1.0.11 (MIT AND Zlib) https://github.com/nodeca/pako (The MIT License) Copyright (C) 2014-2017 by Vitaly Puzrin and Andrei Tuputcyn Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== papaparse@5.3.2 MIT https://github.com/mholt/PapaParse The MIT License (MIT) Copyright (c) 2015 Matthew Holt Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== parse-entities@4.0.2 MIT https://github.com/wooorm/parse-entities (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== path-is-absolute@1.0.1 MIT https://github.com/sindresorhus/path-is-absolute The MIT License (MIT) Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== path-key@3.1.1 MIT https://github.com/sindresorhus/path-key MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== path-scurry@1.11.1 BlueOak-1.0.0 https://github.com/isaacs/path-scurry # Blue Oak Model License Version 1.0.0 ## Purpose This license gives everyone as much permission to work with this software as possible, while protecting contributors from liability. ## Acceptance In order to receive this license, you must agree to its rules. The rules of this license are both obligations under that agreement and conditions to your license. You must not do anything with this software that triggers a rule that you cannot or will not follow. ## Copyright Each contributor licenses you to do everything with this software that would otherwise infringe that contributor's copyright in it. ## Notices You must ensure that everyone who gets a copy of any part of this software from you, with or without changes, also gets the text of this license or a link to . ## Excuse If anyone notifies you in writing that you have not complied with [Notices](#notices), you can keep your license by taking all practical steps to comply within 30 days after the notice. If you do not do so, your license ends immediately. ## Patent Each contributor licenses you to do everything with this software that would otherwise infringe any patent claims they can license or become able to license. ## Reliability No contributor can revoke this license. ## No Liability ***As far as the law allows, this software comes as is, without any warranty or condition, and no contributor will be liable to anyone for any damages related to this software or this license, under any kind of legal claim.*** ====================================================================== path-to-regexp@1.9.0 MIT https://github.com/pillarjs/path-to-regexp The MIT License (MIT) Copyright (c) 2014 Blake Embrey (hello@blakeembrey.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== paths-js@0.4.11 Apache-2.0 https://github.com/andreaferretti/paths-js Paths.js ======== [![Build Status](https://travis-ci.org/andreaferretti/paths-js.svg?branch=master)](https://travis-ci.org/andreaferretti/paths-js) Paths.js is a library to generate [SVG paths](http://www.w3.org/TR/SVG/paths.html), allowing you to create your own charts using a functional and testable API. It provides the primitives to create various shapes and charts starting from raw data, but it does not prescribe how you render these charts. This means you can use Paths.js to build components for your favorite frontend framework, and works even server-side on [NodeJS](http://nodejs.org/). Paths.js offers three APIs, of increasing abstraction. The lowest level is a chainable API to generate an arbitrary SVG path. On top of this, paths for simple geometric shapes such as polygons or circle sectors are defined. At the highest level, there is an API to generate some simple graphs (pie, line chart, radar...) for a collection of data, assembling the simple shapes. Latest version is `0.4.6` - see [this](#migration-to-04) for the necessary changes from `0.3.5`. Table of contents ----------------- - [Demos](#demos) - [Philosophy](#philosophy) - [Documentation](#documentation) - [Resources](#resources) - [Browser support](#browser-support) - [Migration to 0.4](#migration-to-04) - [Using Paths.js with the Canvas API](#using-pathsjs-with-the-canvas-api) - [Using Paths.js with Scala.js](#using-pathsjs-with-scalajs) - [Contributing](#contributing) Demos ----- Of course, when judging a chart library, the first request is to have a look at results. But Paths.js is different: it provides the geometry, and you draw the charts. That said, we have two demos. The [first one](http://andreaferretti.github.io/paths-js-react-demo) is written using React ([source here](https://github.com/andreaferretti/paths-js-react-demo)). The [old demo](http://andreaferretti.github.io/paths-js-demo/) is written using Ractive ([source here](https://github.com/andreaferretti/paths-js-demo)). Philosophy ---------- Drawing beautiful charts is a craft, and often one needs to add custom interactions, styling or animations. There are some beautiful chart libraries out there, such as [Flotcharts](http://www.flotcharts.org/) or [Dimple](http://dimplejs.org/), and if those are enough for your needs, they can be a pleasure to use. In many cases, though, what I really wanted was a library to take care of the generation of the chart, while still leaving me the possibility to render the actual thing. Paths.js does exactly this. It eventually generates [SVG paths](http://www.w3.org/TR/SVG/paths.html) with a high level API. These paths can be then used together with a template engine such as [Mustache](http://mustache.github.io/) or [Handlebars](http://handlebarsjs.com/) to display SVG graphics in the browser. If instead of a static template engine, you use a data binding library, such as [Facebook React](http://facebook.github.io/react/), [Ractive.js](http://www.ractivejs.org/) or [Angular](http://angularjs.org/), you get animated graphics for free. In designing Paths.js, I have tried to follow a few principles: * paths should be immutable * all exposed methods should be pure * from this follows that it is trivial to test components * and that they work on Node.js as well * it should be easy to integrate Paths.js into various frameworks Documentation ------------- A detailed documentation is available on the [wiki](). Here are links to the main entry points. Paths.js offers three APIs, of increasing abstraction. The lowest level is a chainable API to generate an arbitrary SVG path. On top of this, paths for simple geometric shapes such as polygons or circle sectors are defined. At the highest level, there is an API to generate some simple graphs (pie, line chart, radar...) for a collection of data, assembling the simple shapes. - [Installation and usage](https://github.com/andreaferretti/paths-js/wiki) - [Low level API](https://github.com/andreaferretti/paths-js/wiki/Low%20level%20API) - [Mid level API (shapes)](https://github.com/andreaferretti/paths-js/wiki/Mid-level-API) - [High level API (graphs)](https://github.com/andreaferretti/paths-js/wiki/High-level-API) - [Miscellaneous](https://github.com/andreaferretti/paths-js/wiki/Miscellaneous) Those users who prefer explicit typed interfaces can [browse the API](http://andreaferretti.github.io/paths-scala-js) of the Scala.js bindings. Resources --------- These resources give a more detailed exposition of the philosophy behind Paths.js: * [Reactive SVG charts with Ractive.js and Paths.js](http://mlarocca.github.io/01-22-2014/pathsjs_ractive.html) by Marcello La Rocca * [My talk at MilanoJS user group](https://github.com/andreaferretti/paths-talk-slides), together with the [examples](https://github.com/andreaferretti/paths-talk-examples) * [Reactive SVG charts with Ractive.js](http://mlarocca.github.io/graphicalweb2014/) * [Visualization is for Sharing: Using React for Portable Data Visualization](http://viget.com/extend/visualization-is-for-sharing-using-react-for-portable-data-visualization) by Nate Hunzaker * [How to Create Performant, Template-based Charts with Paths.js](http://www.sitepoint.com/create-performant-template-based-charts-paths-js/) Browser support --------------- Paths.js works in any environment that supports a modern version of Javascript, namely ES5. This includes any version of Node.js and all recent browsers. If you need support for older browsers, you can include an [ES5 polyfill](https://github.com/kriskowal/es5-shim/). On the other hand, not every browser will be able to display the SVG graphics that you will generate. Usually, recent desktop browsers are ok, but mobile browser are slow in adopting the SVG specification. You can refer to [caniuse](http://caniuse.com/#search=svg) for more detailed information. Migration to 0.4 ---------------- Version 0.4 was rewritten in ES6 instead of CoffeeScript for future-proofing. The currently published version is `0.4.0`. A few API changes were introduced, namely all keys are now camel cased. In particular: * in the low-level verbose API, `large_arc_flag` has been renamed to `largeArcFlag`, and `sweep_flag` to `sweepFlag` * the rectangle width in the Sankey diagram, is now called `rectWidth` instead of `rect_width` Also, the default for the `gutter` parameter is now `10` everywhere (that is, also in the `Bar` and `Waterfall` charts). Everything else should be the same, so if you find any regression, please open a issue. Using Paths.js with the Canvas API ---------------------------------- Paths.js does not directly support the [canvas element](http://en.wikipedia.org/wiki/Canvas_element), essentially because there is no need to do so. The [canvg](https://github.com/gabelerner/canvg) project allows to draw SVG paths on a `` element, and it seems that canvas [will be able](http://lists.w3.org/Archives/Public/public-whatwg-archive/2012Mar/0269.html) to support SVG paths natively. Of course, canvas-based solutions limit the possibilities offered by data binding libraries for interaction, but they could be used as a fallback on less recent browsers. Using Paths.js with Scala.js ---------------------------- It is possible to use Paths.js with [Scala.js](http://www.scala-js.org/) - [this library](https://github.com/andreaferretti/paths-scala-js) defines the bindings. Contributing ------------ Contributions to Paths.js are always welcome! See [this wiki page](https://github.com/andreaferretti/paths-js/wiki/Contributing) for suggestions and guidelines. ====================================================================== pluralize@7.0.0 MIT https://github.com/blakeembrey/pluralize The MIT License (MIT) Copyright (c) 2013 Blake Embrey (hello@blakeembrey.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== popper.js@1.16.1 MIT https://github.com/FezVrasta/popper.js

Popper.js

A library used to position poppers in web applications.

Stable Release Size Stable Release Size Istanbul Code Coverage Dependents packages Get support or discuss
Build Status SauceLabs Reports

## Wut? Poppers? A popper is an element on the screen which "pops out" from the natural flow of your application. Common examples of poppers are tooltips, popovers and drop-downs. ## So, yet another tooltip library? Well, basically, **no**. Popper.js is a **positioning engine**, its purpose is to calculate the position of an element to make it possible to position it near a given reference element. The engine is completely modular and most of its features are implemented as **modifiers** (similar to middlewares or plugins). The whole code base is written in ES2015 and its features are automatically tested on real browsers thanks to [SauceLabs](https://saucelabs.com/) and [TravisCI](https://travis-ci.org/). Popper.js has zero dependencies. No jQuery, no LoDash, nothing. It's used by big companies like [Twitter in Bootstrap v4](https://getbootstrap.com/), [Microsoft in WebClipper](https://github.com/OneNoteDev/WebClipper) and [Atlassian in AtlasKit](https://aui-cdn.atlassian.com/atlaskit/registry/). ### Popper.js This is the engine, the library that computes and, optionally, applies the styles to the poppers. Some of the key points are: - Position elements keeping them in their original DOM context (doesn't mess with your DOM!); - Allows to export the computed informations to integrate with React and other view libraries; - Supports Shadow DOM elements; - Completely customizable thanks to the modifiers based structure; Visit our [project page](https://fezvrasta.github.io/popper.js) to see a lot of examples of what you can do with Popper.js! Find [the documentation here](/docs/_includes/popper-documentation.md). ### Tooltip.js Since lots of users just need a simple way to integrate powerful tooltips in their projects, we created **Tooltip.js**. It's a small library that makes it easy to automatically create tooltips using as engine Popper.js. Its API is almost identical to the famous tooltip system of Bootstrap, in this way it will be easy to integrate it in your projects. The tooltips generated by Tooltip.js are accessible thanks to the `aria` tags. Find [the documentation here](/docs/_includes/tooltip-documentation.md). ## Installation Popper.js is available on the following package managers and CDNs: | Source | | |:-------|:---------------------------------------------------------------------------------| | npm | `npm install popper.js --save` | | yarn | `yarn add popper.js` | | NuGet | `PM> Install-Package popper.js` | | Bower | `bower install popper.js --save` | | unpkg | [`https://unpkg.com/popper.js`](https://unpkg.com/popper.js) | | cdnjs | [`https://cdnjs.com/libraries/popper.js`](https://cdnjs.com/libraries/popper.js) | Tooltip.js as well: | Source | | |:-------|:---------------------------------------------------------------------------------| | npm | `npm install tooltip.js --save` | | yarn | `yarn add tooltip.js` | | Bower* | `bower install tooltip.js=https://unpkg.com/tooltip.js --save` | | unpkg | [`https://unpkg.com/tooltip.js`](https://unpkg.com/tooltip.js) | | cdnjs | [`https://cdnjs.com/libraries/popper.js`](https://cdnjs.com/libraries/popper.js) | \*: Bower isn't officially supported, it can be used to install Tooltip.js only trough the unpkg.com CDN. This method has the limitation of not being able to define a specific version of the library. Bower and Popper.js suggests to use npm or Yarn for your projects. For more info, [read the related issue](https://github.com/FezVrasta/popper.js/issues/390). ### Dist targets Popper.js is currently shipped with 3 targets in mind: UMD, ESM and ESNext. - UMD - Universal Module Definition: AMD, RequireJS and globals; - ESM - ES Modules: For webpack/Rollup or browser supporting the spec; - ESNext: Available in `dist/`, can be used with webpack and `babel-preset-env`; Make sure to use the right one for your needs. If you want to import it with a ` ``` ```js var input = document.querySelector('input'); var result = select(input); ``` ### Browserify ```js var select = require('select'); ``` ```js var input = document.querySelector('input'); var result = select(input); ``` ## License [MIT License](http://zenorocha.mit-license.org/) © Zeno Rocha ====================================================================== semver@7.8.5 ISC https://github.com/npm/node-semver The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== set-function-length@1.2.2 MIT https://github.com/ljharb/set-function-length MIT License Copyright (c) Jordan Harband and contributors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== set-function-name@2.0.2 MIT https://github.com/ljharb/set-function-name MIT License Copyright (c) Jordan Harband and contributors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== setimmediate@1.0.5 MIT https://github.com/YuzuJS/setImmediate Copyright (c) 2012 Barnesandnoble.com, llc, Donavon West, and Domenic Denicola Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== shallowequal@1.1.0 MIT https://github.com/dashed/shallowequal MIT License Copyright (c) 2017 Alberto Leal (github.com/dashed) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== shebang-command@2.0.0 MIT https://github.com/kevva/shebang-command MIT License Copyright (c) Kevin Mårtensson (github.com/kevva) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== shebang-regex@3.0.0 MIT https://github.com/sindresorhus/shebang-regex MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== shortid@2.2.16 MIT https://github.com/dylang/shortid Copyright (c) Dylan Greene All rights reserved. MIT +no-false-attribs License Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. Distributions of all or part of the Software intended to be used by the recipients as they would use the unmodified Software, containing modifications that substantially alter, remove, or disable functionality of the Software, outside of the documented configuration mechanisms provided by the Software, shall be modified such that the Original Author's bug reporting email addresses and urls are either replaced with the contact information of the parties responsible for the changes, or removed entirely. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== side-channel-list@1.0.1 MIT https://github.com/ljharb/side-channel-list MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== side-channel-map@1.0.1 MIT https://github.com/ljharb/side-channel-map MIT License Copyright (c) 2024 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== side-channel-weakmap@1.0.2 MIT https://github.com/ljharb/side-channel-weakmap MIT License Copyright (c) 2019 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== side-channel@1.1.1 MIT https://github.com/ljharb/side-channel MIT License Copyright (c) 2019 Jordan Harband Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== signal-exit@4.1.0 ISC https://github.com/tapjs/signal-exit The ISC License Copyright (c) 2015-2023 Benjamin Coe, Isaac Z. Schlueter, and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== simple-swizzle@0.2.4 MIT https://github.com/qix-/node-simple-swizzle The MIT License (MIT) Copyright (c) 2015 Josh Junon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== slide@1.1.6 ISC https://github.com/isaacs/slide-flow-control The ISC License Copyright (c) Isaac Z. Schlueter Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== space-separated-tokens@2.0.2 MIT https://github.com/wooorm/space-separated-tokens (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== spdx-compare@1.0.0 MIT https://github.com/kemitchell/spdx-compare.js The MIT License Copyright (c) 2015 Kyle E. Mitchell Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== spdx-correct@3.2.0 Apache-2.0 https://github.com/jslicense/spdx-correct.js Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "[]" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright [yyyy] [name of copyright owner] Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== spdx-exceptions@2.5.0 CC-BY-3.0 https://github.com/kemitchell/spdx-exceptions.json The package exports an array of strings. Each string is an identifier for a license exception under the [Software Package Data Exchange (SPDX)][SPDX] software license metadata standard. [SPDX]: https://spdx.org ## Copyright and Licensing ### SPDX "SPDX" is a federally registered United States trademark of The Linux Foundation Corporation. From version 2.0 of the [SPDX] specification: > Copyright © 2010-2015 Linux Foundation and its Contributors. Licensed > under the Creative Commons Attribution License 3.0 Unported. All other > rights are expressly reserved. The Linux Foundation and the SPDX working groups are good people. Only they decide what "SPDX" means, as a standard and otherwise. I respect their work and their rights. You should, too. ### This Package > I created this package by copying exception identifiers out of the > SPDX specification. That work was mechanical, routine, and required no > creativity whatsoever. - Kyle Mitchell, package author United States users concerned about intellectual property may wish to discuss the following Supreme Court decisions with their attorneys: - _Baker v. Selden_, 101 U.S. 99 (1879) - _Feist Publications, Inc., v. Rural Telephone Service Co._, 499 U.S. 340 (1991) ====================================================================== spdx-expression-parse@3.0.1 MIT https://github.com/jslicense/spdx-expression-parse.js The MIT License Copyright (c) 2015 Kyle E. Mitchell & other authors listed in AUTHORS Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== spdx-license-ids@3.0.24 CC0-1.0 https://github.com/jslicense/spdx-license-ids # spdx-license-ids [![npm version](https://img.shields.io/npm/v/spdx-license-ids.svg)](https://www.npmjs.com/package/spdx-license-ids) A list of [SPDX license](https://spdx.org/licenses/) identifiers ## Installation [Download JSON directly](https://raw.githubusercontent.com/jslicense/spdx-license-ids/main/index.json), or [use](https://docs.npmjs.com/cli/install) [npm](https://docs.npmjs.com/about-npm/): ``` npm install spdx-license-ids ``` ## [Node.js](https://nodejs.org/) API ### require('spdx-license-ids') Type: `string[]` All license IDs except for the currently deprecated ones. ```javascript const ids = require('spdx-license-ids'); //=> ['0BSD', 'AAL', 'ADSL', 'AFL-1.1', 'AFL-1.2', 'AFL-2.0', 'AFL-2.1', 'AFL-3.0', 'AGPL-1.0-only', ...] ids.includes('BSD-3-Clause'); //=> true ids.includes('CC-BY-1.0'); //=> true ids.includes('GPL-3.0'); //=> false ``` ### require('spdx-license-ids/deprecated') Type: `string[]` Deprecated license IDs. ```javascript const deprecatedIds = require('spdx-license-ids/deprecated'); //=> ['AGPL-1.0', 'AGPL-3.0', 'GFDL-1.1', 'GFDL-1.2', 'GFDL-1.3', 'GPL-1.0', 'GPL-2.0', ...] deprecatedIds.includes('BSD-3-Clause'); //=> false deprecatedIds.includes('CC-BY-1.0'); //=> false deprecatedIds.includes('GPL-3.0'); //=> true ``` ## License [Creative Commons Zero v1.0 Universal](https://creativecommons.org/publicdomain/zero/1.0/deed) ====================================================================== spdx-ranges@2.1.1 (MIT AND CC-BY-3.0) https://github.com/kemitchell/spdx-ranges.js The MIT License Copyright (c) 2015 Kyle E. Mitchell Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== spdx-satisfies@5.0.1 MIT https://github.com/kemitchell/spdx-satisfies.js The MIT License Copyright (c) spdx-satisfies.js contributors Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== stream-browserify@3.0.0 MIT https://github.com/browserify/stream-browserify MIT License Copyright (c) James Halliday Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== string-splice@1.3.0 ISC https://github.com/tnrich/string-splice [![Build Status](https://travis-ci.org/tnrich/string-splice.svg?branch=master)](https://travis-ci.org/tnrich/string-splice) #Useage: ``` splice(str, index, count, add) ``` #Example ``` var splice = require('string-splice') ; var exampleString = 'abcdefg' splice(exampleString, 1, 2, 'ZZZ'); //'aZZZdefg' ``` #Attributions: Taken from the answer to this stack overflow question: http://stackoverflow.com/questions/20817618/is-there-a-splice-method-for-strings ====================================================================== string-width@4.2.3 MIT https://github.com/sindresorhus/string-width MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== string-width@5.1.2 MIT https://github.com/sindresorhus/string-width MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== string_decoder@1.1.1 MIT https://github.com/nodejs/string_decoder Node.js is licensed for use as follows: """ Copyright Node.js contributors. All rights reserved. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ This license applies to parts of Node.js originating from the https://github.com/joyent/node repository: """ Copyright Joyent, Inc. and other Node contributors. All rights reserved. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ ====================================================================== stringify-entities@4.0.4 MIT https://github.com/wooorm/stringify-entities (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== strip-ansi@6.0.1 MIT https://github.com/chalk/strip-ansi MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== strip-ansi@7.2.0 MIT https://github.com/chalk/strip-ansi MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== strnum@1.1.2 MIT https://github.com/NaturalIntelligence/strnum MIT License Copyright (c) 2021 Natural Intelligence Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== style-to-js@1.1.21 MIT https://github.com/remarkablemark/style-to-js The MIT License (MIT) Copyright (c) 2020 Menglin "Mark" Xu Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== style-to-object@1.0.14 MIT https://github.com/remarkablemark/style-to-object The MIT License (MIT) Copyright (c) 2017 Menglin "Mark" Xu Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== supports-color@7.2.0 MIT https://github.com/chalk/supports-color MIT License Copyright (c) Sindre Sorhus (sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== symbol-observable@1.2.0 MIT https://github.com/blesh/symbol-observable The MIT License (MIT) Copyright (c) Sindre Sorhus (sindresorhus.com) Copyright (c) Ben Lesh Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tar-stream@2.2.0 MIT https://github.com/mafintosh/tar-stream The MIT License (MIT) Copyright (c) 2014 Mathias Buus Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== text-segmentation@1.0.3 MIT https://github.com/niklasvh/text-segmentation Copyright (c) 2021 Niklas von Hertzen Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tg-use-local-storage-state@16.0.3 MIT https://github.com/tnrich/use-local-storage-state MIT License Copyright (c) Antonio Stoilkov hello@astoilkov.com http://astoilkov.com Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== throttle-debounce@2.3.0 MIT https://github.com/niksy/throttle-debounce Copyright (c) Ivan Nikolić Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. --- Copyright (c) 2010 "Cowboy" Ben Alman Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. --- GNU GENERAL PUBLIC LICENSE Version 2, June 1991 Copyright (C) 1989, 1991 Free Software Foundation, Inc. 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed. Preamble The licenses for most software are designed to take away your freedom to share and change it. By contrast, the GNU General Public License is intended to guarantee your freedom to share and change free software--to make sure the software is free for all its users. This General Public License applies to most of the Free Software Foundation's software and to any other program whose authors commit to using it. (Some other Free Software Foundation software is covered by the GNU Lesser General Public License instead.) You can apply it to your programs, too. When we speak of free software, we are referring to freedom, not price. Our General Public Licenses are designed to make sure that you have the freedom to distribute copies of free software (and charge for this service if you wish), that you receive source code or can get it if you want it, that you can change the software or use pieces of it in new free programs; and that you know you can do these things. To protect your rights, we need to make restrictions that forbid anyone to deny you these rights or to ask you to surrender the rights. These restrictions translate to certain responsibilities for you if you distribute copies of the software, or if you modify it. For example, if you distribute copies of such a program, whether gratis or for a fee, you must give the recipients all the rights that you have. You must make sure that they, too, receive or can get the source code. And you must show them these terms so they know their rights. We protect your rights with two steps: (1) copyright the software, and (2) offer you this license which gives you legal permission to copy, distribute and/or modify the software. Also, for each author's protection and ours, we want to make certain that everyone understands that there is no warranty for this free software. If the software is modified by someone else and passed on, we want its recipients to know that what they have is not the original, so that any problems introduced by others will not reflect on the original authors' reputations. Finally, any free program is threatened constantly by software patents. We wish to avoid the danger that redistributors of a free program will individually obtain patent licenses, in effect making the program proprietary. To prevent this, we have made it clear that any patent must be licensed for everyone's free use or not licensed at all. The precise terms and conditions for copying, distribution and modification follow. GNU GENERAL PUBLIC LICENSE TERMS AND CONDITIONS FOR COPYING, DISTRIBUTION AND MODIFICATION 0. This License applies to any program or other work which contains a notice placed by the copyright holder saying it may be distributed under the terms of this General Public License. The "Program", below, refers to any such program or work, and a "work based on the Program" means either the Program or any derivative work under copyright law: that is to say, a work containing the Program or a portion of it, either verbatim or with modifications and/or translated into another language. (Hereinafter, translation is included without limitation in the term "modification".) Each licensee is addressed as "you". Activities other than copying, distribution and modification are not covered by this License; they are outside its scope. The act of running the Program is not restricted, and the output from the Program is covered only if its contents constitute a work based on the Program (independent of having been made by running the Program). Whether that is true depends on what the Program does. 1. You may copy and distribute verbatim copies of the Program's source code as you receive it, in any medium, provided that you conspicuously and appropriately publish on each copy an appropriate copyright notice and disclaimer of warranty; keep intact all the notices that refer to this License and to the absence of any warranty; and give any other recipients of the Program a copy of this License along with the Program. You may charge a fee for the physical act of transferring a copy, and you may at your option offer warranty protection in exchange for a fee. 2. You may modify your copy or copies of the Program or any portion of it, thus forming a work based on the Program, and copy and distribute such modifications or work under the terms of Section 1 above, provided that you also meet all of these conditions: a) You must cause the modified files to carry prominent notices stating that you changed the files and the date of any change. b) You must cause any work that you distribute or publish, that in whole or in part contains or is derived from the Program or any part thereof, to be licensed as a whole at no charge to all third parties under the terms of this License. c) If the modified program normally reads commands interactively when run, you must cause it, when started running for such interactive use in the most ordinary way, to print or display an announcement including an appropriate copyright notice and a notice that there is no warranty (or else, saying that you provide a warranty) and that users may redistribute the program under these conditions, and telling the user how to view a copy of this License. (Exception: if the Program itself is interactive but does not normally print such an announcement, your work based on the Program is not required to print an announcement.) These requirements apply to the modified work as a whole. If identifiable sections of that work are not derived from the Program, and can be reasonably considered independent and separate works in themselves, then this License, and its terms, do not apply to those sections when you distribute them as separate works. But when you distribute the same sections as part of a whole which is a work based on the Program, the distribution of the whole must be on the terms of this License, whose permissions for other licensees extend to the entire whole, and thus to each and every part regardless of who wrote it. Thus, it is not the intent of this section to claim rights or contest your rights to work written entirely by you; rather, the intent is to exercise the right to control the distribution of derivative or collective works based on the Program. In addition, mere aggregation of another work not based on the Program with the Program (or with a work based on the Program) on a volume of a storage or distribution medium does not bring the other work under the scope of this License. 3. You may copy and distribute the Program (or a work based on it, under Section 2) in object code or executable form under the terms of Sections 1 and 2 above provided that you also do one of the following: a) Accompany it with the complete corresponding machine-readable source code, which must be distributed under the terms of Sections 1 and 2 above on a medium customarily used for software interchange; or, b) Accompany it with a written offer, valid for at least three years, to give any third party, for a charge no more than your cost of physically performing source distribution, a complete machine-readable copy of the corresponding source code, to be distributed under the terms of Sections 1 and 2 above on a medium customarily used for software interchange; or, c) Accompany it with the information you received as to the offer to distribute corresponding source code. (This alternative is allowed only for noncommercial distribution and only if you received the program in object code or executable form with such an offer, in accord with Subsection b above.) The source code for a work means the preferred form of the work for making modifications to it. For an executable work, complete source code means all the source code for all modules it contains, plus any associated interface definition files, plus the scripts used to control compilation and installation of the executable. However, as a special exception, the source code distributed need not include anything that is normally distributed (in either source or binary form) with the major components (compiler, kernel, and so on) of the operating system on which the executable runs, unless that component itself accompanies the executable. If distribution of executable or object code is made by offering access to copy from a designated place, then offering equivalent access to copy the source code from the same place counts as distribution of the source code, even though third parties are not compelled to copy the source along with the object code. 4. You may not copy, modify, sublicense, or distribute the Program except as expressly provided under this License. Any attempt otherwise to copy, modify, sublicense or distribute the Program is void, and will automatically terminate your rights under this License. However, parties who have received copies, or rights, from you under this License will not have their licenses terminated so long as such parties remain in full compliance. 5. You are not required to accept this License, since you have not signed it. However, nothing else grants you permission to modify or distribute the Program or its derivative works. These actions are prohibited by law if you do not accept this License. Therefore, by modifying or distributing the Program (or any work based on the Program), you indicate your acceptance of this License to do so, and all its terms and conditions for copying, distributing or modifying the Program or works based on it. 6. Each time you redistribute the Program (or any work based on the Program), the recipient automatically receives a license from the original licensor to copy, distribute or modify the Program subject to these terms and conditions. You may not impose any further restrictions on the recipients' exercise of the rights granted herein. You are not responsible for enforcing compliance by third parties to this License. 7. If, as a consequence of a court judgment or allegation of patent infringement or for any other reason (not limited to patent issues), conditions are imposed on you (whether by court order, agreement or otherwise) that contradict the conditions of this License, they do not excuse you from the conditions of this License. If you cannot distribute so as to satisfy simultaneously your obligations under this License and any other pertinent obligations, then as a consequence you may not distribute the Program at all. For example, if a patent license would not permit royalty-free redistribution of the Program by all those who receive copies directly or indirectly through you, then the only way you could satisfy both it and this License would be to refrain entirely from distribution of the Program. If any portion of this section is held invalid or unenforceable under any particular circumstance, the balance of the section is intended to apply and the section as a whole is intended to apply in other circumstances. It is not the purpose of this section to induce you to infringe any patents or other property right claims or to contest validity of any such claims; this section has the sole purpose of protecting the integrity of the free software distribution system, which is implemented by public license practices. Many people have made generous contributions to the wide range of software distributed through that system in reliance on consistent application of that system; it is up to the author/donor to decide if he or she is willing to distribute software through any other system and a licensee cannot impose that choice. This section is intended to make thoroughly clear what is believed to be a consequence of the rest of this License. 8. If the distribution and/or use of the Program is restricted in certain countries either by patents or by copyrighted interfaces, the original copyright holder who places the Program under this License may add an explicit geographical distribution limitation excluding those countries, so that distribution is permitted only in or among countries not thus excluded. In such case, this License incorporates the limitation as if written in the body of this License. 9. The Free Software Foundation may publish revised and/or new versions of the General Public License from time to time. Such new versions will be similar in spirit to the present version, but may differ in detail to address new problems or concerns. Each version is given a distinguishing version number. If the Program specifies a version number of this License which applies to it and "any later version", you have the option of following the terms and conditions either of that version or of any later version published by the Free Software Foundation. If the Program does not specify a version number of this License, you may choose any version ever published by the Free Software Foundation. 10. If you wish to incorporate parts of the Program into other free programs whose distribution conditions are different, write to the author to ask for permission. For software which is copyrighted by the Free Software Foundation, write to the Free Software Foundation; we sometimes make exceptions for this. Our decision will be guided by the two goals of preserving the free status of all derivatives of our free software and of promoting the sharing and reuse of software generally. NO WARRANTY 11. BECAUSE THE PROGRAM IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR OR CORRECTION. 12. IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR REDISTRIBUTE THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. ====================================================================== tiny-emitter@2.1.0 MIT https://github.com/scottcorgan/tiny-emitter The MIT License (MIT) Copyright (c) 2017 Scott Corgan Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tiny-invariant@1.3.3 MIT https://github.com/alexreardon/tiny-invariant MIT License Copyright (c) 2019 Alexander Reardon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tiny-warning@1.0.3 MIT https://github.com/alexreardon/tiny-warning MIT License Copyright (c) 2019 Alexander Reardon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tinycolor2@1.6.0 MIT https://github.com/bgrins/TinyColor Copyright (c), Brian Grinstead, http://briangrinstead.com Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tippy.js@6.3.7 MIT https://github.com/atomiks/tippyjs MIT License Copyright (c) 2017-present atomiks Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== toggle-selection@1.0.6 MIT https://github.com/sudodoki/toggle-selection # Toggle Selection Simple module exposing function that deselects current browser selection and returns function that restores selection. ``` var deselect = require('toggle-selection'); var reselect = deselect(); // remove all selection // … // do something with current selection, text, etc; // … reselect(); // restore selection ``` All credits go to [@shvaikalesh](https://github.com/shvaikalesh). # [Example](https://github.com/sudodoki/toggle-selection/blob/master/example) ![example recording](http://g.recordit.co/YPu6mHvcKe.gif) ====================================================================== treeify@1.1.0 MIT https://github.com/notatestuser/treeify The MIT License (MIT) Copyright (c) 2012-2018 Luke Plaster Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== trim-lines@3.0.1 MIT https://github.com/wooorm/trim-lines (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== trough@2.2.0 MIT https://github.com/wooorm/trough (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== tslib@1.13.0 0BSD https://github.com/Microsoft/tslib Copyright (c) Microsoft Corporation. Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== tslib@2.3.1 0BSD https://github.com/Microsoft/tslib Copyright (c) Microsoft Corporation. Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== tslib@2.5.3 0BSD https://github.com/Microsoft/tslib Copyright (c) Microsoft Corporation. Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== tslib@2.6.2 0BSD https://github.com/Microsoft/tslib Copyright (c) Microsoft Corporation. Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== typed-styles@0.0.7 MIT MIT License Copyright (c) 2017 Artur Kenzhaev Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== unified@11.0.5 MIT https://github.com/unifiedjs/unified (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== unist-util-is@6.0.1 MIT https://github.com/syntax-tree/unist-util-is (The MIT license) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== unist-util-position@5.0.0 MIT https://github.com/syntax-tree/unist-util-position (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== unist-util-stringify-position@4.0.0 MIT https://github.com/syntax-tree/unist-util-stringify-position (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== unist-util-visit-parents@6.0.2 MIT https://github.com/syntax-tree/unist-util-visit-parents (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== unist-util-visit@5.1.0 MIT https://github.com/syntax-tree/unist-util-visit (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== url-join@4.0.1 MIT https://github.com/jfromaniello/url-join MIT License Copyright (c) 2015 José F. Romaniello Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== use-debounce@8.0.4 MIT https://github.com/xnimorz/use-debounce MIT License Copyright (c) 2018 Nikita Mostovoy Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== use-deep-compare-effect@1.8.1 MIT https://github.com/kentcdodds/use-deep-compare-effect The MIT License (MIT) Copyright (c) 2020 Kent C. Dodds Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== use-memo-one@1.1.3 MIT https://github.com/alexreardon/use-memo-one MIT License Copyright (c) 2019 Alexander Reardon Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== use-sync-external-store@1.7.0 MIT https://github.com/react/react MIT License Copyright (c) Meta Platforms, Inc. and affiliates. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== util-deprecate@1.0.2 MIT https://github.com/TooTallNate/util-deprecate (The MIT License) Copyright (c) 2014 Nathan Rajlich Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== utrie@1.0.2 MIT https://github.com/niklasvh/utrie Copyright (c) 2021 Niklas von Hertzen Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== validate-npm-package-license@3.0.4 Apache-2.0 https://github.com/kemitchell/validate-npm-package-license.js Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. Definitions. "License" shall mean the terms and conditions for use, reproduction, and distribution as defined by Sections 1 through 9 of this document. "Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. "Legal Entity" shall mean the union of the acting entity and all other entities that control, are controlled by, or are under common control with that entity. For the purposes of this definition, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. "You" (or "Your") shall mean an individual or Legal Entity exercising permissions granted by this License. "Source" form shall mean the preferred form for making modifications, including but not limited to software source code, documentation source, and configuration files. "Object" form shall mean any form resulting from mechanical transformation or translation of a Source form, including but not limited to compiled object code, generated documentation, and conversions to other media types. "Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). "Derivative Works" shall mean any work, whether in Source or Object form, that is based on (or derived from) the Work and for which the editorial revisions, annotations, elaborations, or other modifications represent, as a whole, an original work of authorship. For the purposes of this License, Derivative Works shall not include works that remain separable from, or merely link (or bind by name) to the interfaces of, the Work and Derivative Works thereof. "Contribution" shall mean any work of authorship, including the original version of the Work and any modifications or additions to that Work or Derivative Works thereof, that is intentionally submitted to Licensor for inclusion in the Work by the copyright owner or by an individual or Legal Entity authorized to submit on behalf of the copyright owner. For the purposes of this definition, "submitted" means any form of electronic, verbal, or written communication sent to the Licensor or its representatives, including but not limited to communication on electronic mailing lists, source code control systems, and issue tracking systems that are managed by, or on behalf of, the Licensor for the purpose of discussing and improving the Work, but excluding communication that is conspicuously marked or otherwise designated in writing by the copyright owner as "Not a Contribution." "Contributor" shall mean Licensor and any individual or Legal Entity on behalf of whom a Contribution has been received by Licensor and subsequently incorporated within the Work. 2. Grant of Copyright License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable copyright license to reproduce, prepare Derivative Works of, publicly display, publicly perform, sublicense, and distribute the Work and such Derivative Works in Source or Object form. 3. Grant of Patent License. Subject to the terms and conditions of this License, each Contributor hereby grants to You a perpetual, worldwide, non-exclusive, no-charge, royalty-free, irrevocable (except as stated in this section) patent license to make, have made, use, offer to sell, sell, import, and otherwise transfer the Work, where such license applies only to those patent claims licensable by such Contributor that are necessarily infringed by their Contribution(s) alone or by combination of their Contribution(s) with the Work to which such Contribution(s) was submitted. If You institute patent litigation against any entity (including a cross-claim or counterclaim in a lawsuit) alleging that the Work or a Contribution incorporated within the Work constitutes direct or contributory patent infringement, then any patent licenses granted to You under this License for that Work shall terminate as of the date such litigation is filed. 4. Redistribution. You may reproduce and distribute copies of the Work or Derivative Works thereof in any medium, with or without modifications, and in Source or Object form, provided that You meet the following conditions: (a) You must give any other recipients of the Work or Derivative Works a copy of this License; and (b) You must cause any modified files to carry prominent notices stating that You changed the files; and (c) You must retain, in the Source form of any Derivative Works that You distribute, all copyright, patent, trademark, and attribution notices from the Source form of the Work, excluding those notices that do not pertain to any part of the Derivative Works; and (d) If the Work includes a "NOTICE" text file as part of its distribution, then any Derivative Works that You distribute must include a readable copy of the attribution notices contained within such NOTICE file, excluding those notices that do not pertain to any part of the Derivative Works, in at least one of the following places: within a NOTICE text file distributed as part of the Derivative Works; within the Source form or documentation, if provided along with the Derivative Works; or, within a display generated by the Derivative Works, if and wherever such third-party notices normally appear. The contents of the NOTICE file are for informational purposes only and do not modify the License. You may add Your own attribution notices within Derivative Works that You distribute, alongside or as an addendum to the NOTICE text from the Work, provided that such additional attribution notices cannot be construed as modifying the License. You may add Your own copyright statement to Your modifications and may provide additional or different license terms and conditions for use, reproduction, or distribution of Your modifications, or for any such Derivative Works as a whole, provided Your use, reproduction, and distribution of the Work otherwise complies with the conditions stated in this License. 5. Submission of Contributions. Unless You explicitly state otherwise, any Contribution intentionally submitted for inclusion in the Work by You to the Licensor shall be under the terms and conditions of this License, without any additional terms or conditions. Notwithstanding the above, nothing herein shall supersede or modify the terms of any separate license agreement you may have executed with Licensor regarding such Contributions. 6. Trademarks. This License does not grant permission to use the trade names, trademarks, service marks, or product names of the Licensor, except as required for reasonable and customary use in describing the origin of the Work and reproducing the content of the NOTICE file. 7. Disclaimer of Warranty. Unless required by applicable law or agreed to in writing, Licensor provides the Work (and each Contributor provides its Contributions) on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied, including, without limitation, any warranties or conditions of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A PARTICULAR PURPOSE. You are solely responsible for determining the appropriateness of using or redistributing the Work and assume any risks associated with Your exercise of permissions under this License. 8. Limitation of Liability. In no event and under no legal theory, whether in tort (including negligence), contract, or otherwise, unless required by applicable law (such as deliberate and grossly negligent acts) or agreed to in writing, shall any Contributor be liable to You for damages, including any direct, indirect, special, incidental, or consequential damages of any character arising as a result of this License or out of the use or inability to use the Work (including but not limited to damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses), even if such Contributor has been advised of the possibility of such damages. 9. Accepting Warranty or Additional Liability. While redistributing the Work or Derivative Works thereof, You may choose to offer, and charge a fee for, acceptance of support, warranty, indemnity, or other liability obligations and/or rights consistent with this License. However, in accepting such obligations, You may act only on Your own behalf and on Your sole responsibility, not on behalf of any other Contributor, and only if You agree to indemnify, defend, and hold each Contributor harmless for any liability incurred by, or claims asserted against, such Contributor by reason of your accepting any such warranty or additional liability. END OF TERMS AND CONDITIONS APPENDIX: How to apply the Apache License to your work. To apply the Apache License to your work, attach the following boilerplate notice, with the fields enclosed by brackets "[]" replaced with your own identifying information. (Don't include the brackets!) The text should be enclosed in the appropriate comment syntax for the file format. We also recommend that a file or class name and description of purpose be included on the same "printed page" as the copyright notice for easier identification within third-party archives. Copyright [yyyy] [name of copyright owner] Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ====================================================================== validate.io-array@1.0.6 MIT https://github.com/validate-io/array The MIT License (MIT) Copyright (c) 2014-2015 Athan Reines. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== validate.io-integer@1.0.5 MIT https://github.com/validate-io/integer The MIT License (MIT) Copyright (c) 2014 Athan Reines. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== validate.io-nonnegative-integer-array@1.0.1 MIT https://github.com/validate-io/nonnegative-integer-array The MIT License (MIT) Copyright (c) 2015 Athan Reines. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== validate.io-nonnegative-integer@1.0.0 MIT https://github.com/validate-io/nonnegative-integer The MIT License (MIT) Copyright (c) 2015 Athan Reines. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== validate.io-number@1.0.3 MIT https://github.com/validate-io/number The MIT License (MIT) Copyright (c) 2014 Athan Reines. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== value-equal@1.0.1 MIT https://github.com/mjackson/value-equal MIT License Copyright (c) Michael Jackson 2016-2018 Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== vfile-message@4.0.3 MIT https://github.com/vfile/vfile-message (The MIT License) Copyright (c) Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== vfile@6.0.3 MIT https://github.com/vfile/vfile (The MIT License) Copyright (c) 2015 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== warning@4.0.3 MIT https://github.com/BerkeleyTrue/warning MIT License Copyright (c) 2013-present, Facebook, Inc. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== which@2.0.2 ISC https://github.com/isaacs/node-which The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== wrap-ansi@7.0.0 MIT https://github.com/chalk/wrap-ansi MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== wrap-ansi@8.1.0 MIT https://github.com/chalk/wrap-ansi MIT License Copyright (c) Sindre Sorhus (https://sindresorhus.com) Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== wrappy@1.0.2 ISC https://github.com/npm/wrappy The ISC License Copyright (c) Isaac Z. Schlueter and Contributors Permission to use, copy, modify, and/or distribute this software for any purpose with or without fee is hereby granted, provided that the above copyright notice and this permission notice appear in all copies. THE SOFTWARE IS PROVIDED "AS IS" AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY SPECIAL, DIRECT, INDIRECT, OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ====================================================================== write-excel-file@1.4.30 MIT git+https://gitlab.com/catamphetamine/write-excel-file MIT License Copyright (c) 2018 gitlab.com/catamphetamine Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== zip-stream@4.1.1 MIT https://github.com/archiverjs/node-zip-stream Copyright (c) 2014 Chris Talkington, contributors. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. ====================================================================== zwitch@2.0.4 MIT https://github.com/wooorm/zwitch (The MIT License) Copyright (c) 2016 Titus Wormer Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the 'Software'), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED 'AS IS', WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. Biopython-derived biological data in sequence-utils https://raw.githubusercontent.com/biopython/biopython/biopython-185/LICENSE.rst Biopython is currently released under the "Biopython License Agreement" (given in full below). Unless stated otherwise in individual file headers, all Biopython's files are under the "Biopython License Agreement". Some files are explicitly dual licensed under your choice of the "Biopython License Agreement" or the "BSD 3-Clause License" (both given in full below). This is with the intention of later offering all of Biopython under this dual licensing approach. ------------------------------------------------------------------------------ Biopython License Agreement --------------------------- Permission to use, copy, modify, and distribute this software and its documentation with or without modifications and for any purpose and without fee is hereby granted, provided that any copyright notices appear in all copies and that both those copyright notices and this permission notice appear in supporting documentation, and that the names of the contributors or copyright holders not be used in advertising or publicity pertaining to distribution of the software without specific prior permission. THE CONTRIBUTORS AND COPYRIGHT HOLDERS OF THIS SOFTWARE DISCLAIM ALL WARRANTIES WITH REGARD TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS, IN NO EVENT SHALL THE CONTRIBUTORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS, WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE. ------------------------------------------------------------------------------ BSD 3-Clause License -------------------- Copyright (c) 1999-2024, The Biopython Contributors All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: 1. Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. 2. Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. 3. Neither the name of the copyright holder nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. SnapGeneFileReader (upstream parser attribution) https://github.com/IsaacLuo/SnapGeneFileReader The MIT License (MIT) [OSI Approved License] The MIT License (MIT) Copyright (c) 2017 Isaac Luo and Cai Lab Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.